Skip to content
Merged
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
32 changes: 32 additions & 0 deletions cookbook/assets/mecA.fasta
Comment thread
danielle-pinto marked this conversation as resolved.
Original file line number Diff line number Diff line change
@@ -0,0 +1,32 @@
>NG_047945.1 Staphylococcus aureus TN/CN/1/12 mecA gene for ceftaroline-resistant PBP2a family peptidoglycan transpeptidase MecA, complete CDS
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATG
CTTCAAAAGATAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAA
AGATAGCAGTTATATTTCTAAAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATAT
AATAGTTTAGGCGTTAAAGATATAAACATTCAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAAC
GAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAACATTGATCGCAACGTTCAATTTAATTTTGT
TAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTCCAGGAATGCAGAAAGACCAA
AGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTGGAATTGGCCA
ATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACC
TTCGTTCCACTTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTA
CAACTAATGAAACAAAAAGTCGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGG
TCCCATTAACTCTGAAGAATTAAAACAAAAAGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAA
AAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATGAAGATGGCTATCGTGTCACAATCGTTGACG
ATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGATGGCAAAGATATTCAACTAAC
TATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGGTACTGCTATC
CACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGAT
TACAACTTCACCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGAC
GATAAAACAAGTTATAAAATCGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTA
CAAGATATGAAGTGGTAAATGGTAATATCGACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTT
TGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAAAAAGGCATGAAAAAACTAGGTGTTGGTGAA
GATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAATTTAGATAATGAAATATTAT
TAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAATCTATAGCGC
ATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATA
AAGAAGATATTTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACA
AGGAGAAACTGGCAGACAAATTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCT
ATTAATGTTAAAGATGTACAAGATAAAGGAATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATG
ATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGATGAATAACAAAACAGTGAAGCAATCCGTAA
CGATGGTTGCTTCACTGTTTTATTATGAATTATTAATAAGTGCTGTTACTTCTCCCTTAAATACAATTTC
TTCATTT
15 changes: 15 additions & 0 deletions cookbook/index.md
Original file line number Diff line number Diff line change
@@ -0,0 +1,15 @@
+++
using Dates
date = Date("2026-03-04")
title = "BioJulia Cookbook"
rss_descr = "Recipes for performing basic bioinformatics in julia"
+++

# BioJulia Cookbook

This cookbook will provide a series of "recipes" that will help get started quickly with BioJulia so you can doing some bioinformatics!

We will have tutorials for reading in files, performing alignments, and using tools such as BLAST,
as well as links to more documentation about specific BioJulia packages.

{{list_dir cookbook}}
235 changes: 235 additions & 0 deletions cookbook/sequences.md
Original file line number Diff line number Diff line change
@@ -0,0 +1,235 @@
+++
using Dates
date = Date("2026-03-11")
title = "Sequence Input/Output"
rss_descr = "Reading in FASTA, FASTQ, and FAI files using FASTX.jl"
+++

# Sequence Input/Output

In this chapter, we'll discuss how to read in sequence files using the `FASTX.jl` package.
More information about the `FASTX.jl` package can be found at https://biojulia.dev/FASTX.jl/stable/
and with the built-in documentation you can access directly within the Julia REPL.

```julia
julia> using FASTX
julia> ?FASTX
```

If `FASTX` is not already in your environment,
it can be easily added from the Julia Registry.

To demonstrate how to use this package,
let's try to read in some real-world data!

The `FASTX` package can read in three file types: `fasta`, `fastq`, and `fai`.

### FASTA files
FASTA files are text files containing biological sequence data.
They contain three parts: `identifier`, `description`, and `sequence`.

The template of a sequence record is:
```
>{description}
{sequence}
```

The `identifier` is the first part of the `description` until the first whitespace.
If there is no whitespace, the `identifier` and `description` are the same.

Here is an example fasta:
```
>chrI chromosome 1
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACC
CACACACACACATCCTAACACTACCCTAACACAGCCCTAATCTA
```

### FASTQ files
FASTQ files are also text-based files that contain sequences, along with an identifier and description.
However, they also store sequence quality information (the Q is for quality!).

The template of a sequence record is:
```
@{description}
{sequence}
+{description}?
{qualities}
```

Here is an example record:
```
@FSRRS4401BE7HA
tcagTTAAGATGGGAT
+
###EEEEEEEEE##E#
```

### FAI files

FAI (FASTA index) files are used in conjunction with FASTA or FASTQ files.
They are text files with TAB-delimited columns.
They allow the user to access specific regions of the reference FASTA/FASTQ without reading in the entire sequence into memory.
More information about fai index files can be found [here](https://www.htslib.org/doc/faidx.html).

```
NAME Name of this reference sequence
LENGTH Total length of this reference sequence, in bases
OFFSET Offset in the FASTA/FASTQ file of this sequence's first base
LINEBASES The number of bases on each line
LINEWIDTH The number of bytes in each line, including the newline
QUALOFFSET Offset of sequence's first quality within the FASTQ file

```

We will read in a FASTA file containing the _mecA_ gene.
_mecA_ is an antibiotic resistance gene commonly found in methicillin-resistant _Staphylococcus aureus_ (MRSA).
It encodes an alternative penicillin-binding protein that allows the bacteria to resist beta-lactam antibiotics like methicillin.
It is typically 2.1 kB long.
This specific reference fasta was downloaded from NCBI [here](https://www.ncbi.nlm.nih.gov/nuccore/NG_047945.1?report=fasta).
More information about this reference sequence can be found [here](https://www.ncbi.nlm.nih.gov/nuccore/NG_047945.1).

First we'll open the file.
Then we'll iterate over every record in the file and print the sequence identifier,
description and then the corresponding sequence.

```julia
julia> FASTAReader(open("assets/mecA.fasta")) do reader
for record in reader
println(identifier(record))
println(description(record))
println(sequence(record))
println(length(sequence(record)))
end
end

NG_047945.1
NG_047945.1 Staphylococcus aureus TN/CN/1/12 mecA gene for ceftaroline-resistant PBP2a family peptidoglycan transpeptidase MecA, complete CDS
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGATAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTAAAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATTCAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAACATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTCCAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTGGAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGCTAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCACTTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAAAAAGTCGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAAAGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATGAAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGATGGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGGTACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATGGCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCACCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAATCGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCGACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAAAAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAATTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAATCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAAAATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATATTTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAATTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGAATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGATGAATAACAAAACAGTGAAGCAATCCGTAACGATGGTTGCTTCACTGTTTTATTATGAATTATTAATAAGTGCTGTTACTTCTCCCTTAAATACAATTTCTTCATTT
2107
```
We confirmed that the length of the gene matches what we'd expect for _mecA_.
In this case, there is only one sequence that spans the entire length of the gene.
After this gene was sequenced, all of the reads were assembled together into a single consensus sequence.
_mecA_ is a well-characterized gene, so there are no ambiguous regions,
and there is no need for there to be multiple contigs
(that is, for the gene to be broken into multiple pieces, since we know how the reads should be assembled).

Let's try reading in a larger FASTQ file.

The raw reads for a _Staphylococcus aureus_ isolate were sequenced with Illumina and uploaded to NCBI [here](https://trace.ncbi.nlm.nih.gov/Traces/index.html?run=SRR1050625).
The link to download the raw FASTQ files can be found [here](https://trace.ncbi.nlm.nih.gov/Traces/index.html?run=SRR1050625).

The BioSample ID for this sample is `SAMN02360768`.
This ID refers to the physical bacterial isolate.
The SRA sample accession number (an internal value used within the Sequence Read Archive) is `SRS515580`.
Both values correspond to one another and are helpful identifiers.

The SRA run accession (SRR) uniquely identifies a sequencing run.
This sample is associated with two runs, and for this example we will download data linked to experiment `SRX392511`.

To download using the command line, type:
```
curl -L --retry 5 --retry-delay 2 \
"https://trace.ncbi.nlm.nih.gov/Traces/sra-reads-be/fastq?acc=SRX392511" \
| gzip -c > SRX392511.fastq.gz
```
Alternatively, command line code can be executed from within Julia:


This file can be downloaded on the command line using `curl`.
> One of the nice things about Julia is that it is
> super easy to toggle between the Julia REPL and
> bash shell by typing `;` to access shell mode
> from Julia.
> You can use the `backspace`/`delete` key to
> quickly toggle back to the Julia REPL.

```julia
run(pipeline(
`curl -L --retry 5 --retry-delay 2 "https://trace.ncbi.nlm.nih.gov/Traces/sra-reads-be/fastq?acc=SRX392511"`,
`gzip -c`,
"SRX392511.fastq.gz"
)
)
```
This file is gzipped, so we'll need to account for that as we are reading it in with `FASTX.jl`.
In Julia, we can decompress gzipped files using `CodecZlib.jl`.

Instead of printing out every record (this isn't super practical because it's a big file), let's save all the records into a vector.

```julia
using CodecZlib

records = []

FASTQReader(GzipDecompressorStream(open("assets/SRX392511.fastq.gz"))) do reader
for record in reader
push!(records, record)
end
end
```

We can see how many reads there are by looking at the length of the vector `records`.

```julia
julia> length(records)
9852716
```

Let's take a look at what the first 10 reads look like:

```
julia> records[1:10]
10-element Vector{Any}:
FASTX.FASTQ.Record("SRX392511.1 1 length=101", "AGGATTTTGTTATATTGTA…", "$$$$$$$$$$$$$$$$$$$…")
FASTX.FASTQ.Record("SRX392511.1 1 length=101", "AGCATAAATTTAAAAAAAA…", "$$$$$$$$$$$$$$$$$$$…")
FASTX.FASTQ.Record("SRX392511.2 2 length=101", "TAGATTAAAATTCTCGTAT…", "???????????????????…")
FASTX.FASTQ.Record("SRX392511.2 2 length=101", "TAGATTAAAATTCTCGTAG…", "???????????????????…")
FASTX.FASTQ.Record("SRX392511.3 3 length=101", "GAGCAGTAGTATAAAATGA…", "???????????????????…")
FASTX.FASTQ.Record("SRX392511.3 3 length=101", "CCGACACAATTACAAGCCA…", "???????????????????…")
FASTX.FASTQ.Record("SRX392511.4 4 length=101", "GATTATCTAGTCATAATTC…", "???????????????????…")
FASTX.FASTQ.Record("SRX392511.4 4 length=101", "TTCGCCCCCCCAAAAGGCT…", "???????????????????…")
FASTX.FASTQ.Record("SRX392511.5 5 length=101", "ATAAAATGAACTTGCGTTA…", "???????????????????…")
FASTX.FASTQ.Record("SRX392511.5 5 length=101", "TAACTTGTGGATAATTATT…", "???????????????????…")
```

Let's calculate the average quality across all reads.
We'll do this by converting each PHRED score to its error probability,
and summing these values across all bases in all reads.
Then, we can divide this sum by the total number of bases
to get the average probability across the entire dataset.
It's important that we first convert the PHRED scores to the probability errors before averaging,
because PHRED is a logarithmic transformation of error probability.
Therefore, simply averaging PHRED and then converting to error probability is not the same as converting PHRED to error probability and averaging that sum.

```julia
function phred_to_prob(Q)
# The formula is Pe = 10^(-Q/10)
return 10^(-Q / 10.0)
end

# get sum of all error probabilities
total_error_prob = sum(
sum(phred_to_prob(q) for q in FASTQ.quality_scores(record))
for record in records
)
4.5100356107423276e7
# get total number of bases
total_bases = sum(length(FASTQ.quality_scores(record)) for record in records)
995124316

# get average error probability
total_error_prob/total_bases
0.045321328584059316
```

The average error probability is just 4.53%,
meaning the majority of reads are high quality.

More information about converting ASCII characters and PHRED scores to quality scores can be found [here](https://people.duke.edu/~ccc14/duke-hts-2018/bioinformatics/quality_scores.html).

Now that we've learned how to read files in and manipulate them a bit,
let's see if we can align the _mecA_ gene to the _Staphylococcus aureus_ genome.
This will tell us if this particular _S. aureus_ is MRSA.


Loading