diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md index f579988625..3c07cfd51d 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/CHANGELOG.md @@ -1,5 +1,17 @@ # Changelog +## [2.4] - 2026-04-20 + +### Automatic update +- `toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3` +- `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2` +- `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3` +- `toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2` +- `toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1` was updated to `toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0` +- `toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1` was updated to `toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0` + ## [2.3] - 2026-03-30 ### Changed diff --git a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga index be27e54db6..53389d04a4 100644 --- a/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga +++ b/workflows/VGP-assembly-v2/hi-c-contact-map-for-assembly-manual-curation/hi-c-map-for-assembly-manual-curation.ga @@ -176,9 +176,9 @@ }, { "child_steps": [ + 34, 43, 44, - 34, 50, 55, 67, @@ -219,7 +219,7 @@ "format-version": "0.1", "license": "MIT", "name": "PretextMap Generation from 1 or 2 haplotypes", - "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Will you use a second haplotype?** [boolean] - Set to true for diploid assemblies\n3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes)\n4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data\n5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads\n\n### Assembly Annotation Parameters\n\n6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n7. **Species Name** [text] - Species identifier for gene annotation\n8. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n10. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Both Haplotypes merged** [fasta] - Concatenated assembly file\n\n### Gene Annotation Outputs\n\n4. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n5. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n6. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n7. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n8. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n9. **Hi-C duplication stats on Scaffolds: MultiQc** [HTML] - MultiQC report of duplicate statistics (if duplicate removal enabled)\n10. **Hi-C duplication stats on Scaffolds: Raw** [tabular] - Raw Samtools markdup metrics (if duplicate removal enabled)\n11. **Pairtools Multiqc Stats on Scaffolds** [tabular] - Pairtools statistics\n12. **Pairtools MultiQc on Scaffolds: Plots** [HTML] - Pairtools MultiQC plots\n\n### PacBio Processing Outputs\n\n13. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n14. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n15. **BigWig Coverage** [bigwig] - PacBio read coverage track\n16. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n17. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n18. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n19. **terminal telomeres** [bedgraph] - All detected telomeric regions\n20. **P telomeres bed** [BED] - P-arm (5') telomeres only\n21. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n22. **Gaps Bed** [BED] - Assembly gap coordinates\n23. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Assembly Haplotype Outputs\n\n24. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n25. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ \u2265 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n26. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n27. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", + "readme": "# Hi-C Contact Map Generation for Manual Curation of Genome Assemblies\n\nThis workflow generates Hi-C contact maps for diploid genome assemblies in the Pretext format. It includes tracks for:\n- **Gene annotations** (Compleasm)\n- **PacBio read coverage** and coverage gaps\n- **Telomeres** (with flexible pattern detection)\n- **Assembly gaps**\n\nThe Pretext files can be opened in PretextView for manual curation of genome assemblies.\n\n## Inputs\n\n### Required Inputs\n\n1. **Haplotype 1** [fasta] - Primary haplotype assembly\n2. **Will you use a second haplotype?** [boolean] - Set to true for diploid assemblies\n3. **Haplotype 2** [fasta] - Secondary haplotype assembly (required if using two haplotypes)\n4. **Hi-C reads** [fastq] - Paired collection containing Hi-C data\n5. **PacBio reads** [fastq] - Collection of PacBio HiFi reads\n\n### Assembly Annotation Parameters\n\n6. **Generate gene annotations** [boolean] - Enable/disable Compleasm gene annotation tracks (disable for large genomes to avoid memory issues)\n7. **Species Name** [text] - Species identifier for gene annotation\n8. **Assembly Name** [text] - Assembly identifier (e.g., toLid)\n9. **Lineage for Compleasm** [text] - BUSCO lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n10. **Database for Compleasm** [text] - Compleasm database version (default: v5)\n\n### Scaffold Naming Options\n\n11. **Do you want to add suffixes to the scaffold names?** [boolean] - Select yes if scaffold names do not contain haplotype information\n12. **First Haplotype suffix** [text] - Suffix for haplotype 1 scaffolds (default: H1)\n13. **Second Haplotype suffix** [text] - Suffix for haplotype 2 scaffolds (default: H2)\n\n### Hi-C Processing Options\n\n14. **Do you want to trim the Hi-C data?** [boolean] - If yes, removes 5bp at the end of Hi-C reads (recommended for Arima Hi-C data if the map looks \"noisy\")\n15. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C alignments using Samtools markdup\n16. **Minimum Mapping Quality** [integer] - Minimum MAPQ score for filtered PretextMap (default: 10; set to 0 to keep all mapped reads)\n\n### PacBio Processing Options\n\n17. **Remove adapters from HiFi reads?** [boolean] - Trim adapters from PacBio HiFi reads using Cutadapt\n\n### Telomere Detection\n\n18. **Canonical telomeric pattern** [text] - Expected telomere repeat sequence (default: TTAGGG for vertebrates; use CCCTAA for reverse complement)\n19. **Telomeric Patterns to explore (comma-separated), IUPAC allowed** [text] - Additional telomeric patterns to search for (e.g., TTAGGG,CCCTAA)\n\n### Hi-C Map Resolution\n\n20. **Generate high resolution Hi-C maps** [boolean] - Generate high resolution Pretext maps (slower, requires more resources)\n\n### Visualization Options\n\n21. **Bin Size for Bigwig files** [integer] - Resolution for coverage tracks (default: 100; larger values = smaller files but lower resolution)\n\n## Outputs\n\n### Assembly Outputs\n\n1. **Assembly for curation** [fasta] - Merged assembly (if two haplotypes used) or single haplotype with optional suffix\n2. **Assembly Info** [tabular] - Summary statistics from gfastats\n3. **Both Haplotypes merged** [fasta] - Concatenated assembly file\n\n### Gene Annotation Outputs\n\n4. **Compleasm Genes track** [GFF] - Combined gene annotations for Pretext track (if gene annotations enabled)\n\n### Hi-C Alignment Outputs\n\n5. **Merged Hi-C Alignments on Scaffolds** [BAM] - Combined Hi-C read alignments\n6. **Precuration Hi-C alignments** [BAM] - Hi-C alignments before filtering\n7. **Trimmed Hi-C data** [fastq] - Hi-C reads after adapter trimming (if trimming enabled)\n8. **Hi-C duplication stats on Scaffolds** [tabular] - Samtools markdup statistics (if duplicate removal enabled)\n9. **Hi-C duplication stats on Scaffolds: MultiQc** [HTML] - MultiQC report of duplicate statistics (if duplicate removal enabled)\n10. **Hi-C duplication stats on Scaffolds: Raw** [tabular] - Raw Samtools markdup metrics (if duplicate removal enabled)\n11. **Pairtools Multiqc Stats on Scaffolds** [tabular] - Pairtools statistics\n12. **Pairtools MultiQc on Scaffolds: Plots** [HTML] - Pairtools MultiQC plots\n\n### PacBio Processing Outputs\n\n13. **HiFi reads without adapters** [fastq] - Adapter-trimmed PacBio reads (if adapter removal enabled)\n14. **HiFi reads adapters trimming report** [tabular] - Cutadapt trimming statistics (if adapter removal enabled)\n\n### PacBio Coverage Outputs\n\n15. **BigWig Coverage** [bigwig] - PacBio read coverage track\n16. **Coverage Gaps Track** [bedgraph] - Regions with low or no PacBio coverage\n17. **Merged HiFi Alignments** [BAM] - Combined PacBio alignments\n\n### Telomere Outputs\n\n18. **Telomere Report** [tabular] - Comprehensive telomere analysis from Teloscope\n19. **terminal telomeres** [bedgraph] - All detected telomeric regions\n20. **P telomeres bed** [BED] - P-arm (5') telomeres only\n21. **Q telomeres Bed** [BED] - Q-arm (3') telomeres only\n\n### Gap Outputs\n\n22. **Gaps Bed** [BED] - Assembly gap coordinates\n23. **Gaps Bedgraph** [bedgraph] - Assembly gap track for Pretext\n\n### Assembly Haplotype Outputs\n\n24. **Decontaminated Hap1 with Suffix** [fasta] - Haplotype 1 with suffix applied\n25. **Decontaminated Hap2 with Suffix** [fasta] - Haplotype 2 with suffix applied\n\n### Pretext Map Outputs\n\nAll Pretext outputs are generated in two versions:\n- **With MAPQ filtering** (default MAPQ ≥ 10): Cleaner maps with high-confidence contacts\n- **Without filtering (Multimapping)**: Shows all mapped contacts including low-quality alignments\n\n26. **Pretext All tracks** [pretext] - Contact map with all annotation tracks (MAPQ filtered)\n27. **Pretext All tracks - Multimapping** [pretext] - Contact map with all tracks (unfiltered)\n28. **Pretext Snapshot With tracks** [PNG] - Image of contact map with tracks (MAPQ filtered)\n29. **Pretext Snapshot With tracks - Multimapping** [PNG] - Image of contact map with tracks (unfiltered)\n\n## Usage Notes\n\n### When to trim Hi-C data\nEnable trimming if you're using Arima Hi-C kits and notice a \"noisy\" contact map pattern.\n\n### MAPQ filtering\nThe default MAPQ threshold of 10 removes ambiguously mapped Hi-C contacts, resulting in cleaner contact maps. Compare both filtered and unfiltered outputs to assess mapping quality.\n\n### Choosing Compleasm lineage\nSelect the most specific lineage available for your species:\n- Vertebrates: `vertebrata_odb10`\n- Mammals: `mammalia_odb10`\n- Primates: `primates_odb10`\n- Birds: `aves_odb10`\n- See [BUSCO datasets](https://busco-data.ezlab.org/v5/data/lineages/) for complete list\n\n### Telomere patterns\n- Vertebrates typically use TTAGGG\n- Some species have variant patterns - check the literature\n- IUPAC codes are supported (e.g., TTAGGK for TTAGGG/TTAGGC)\n\n## Citation\n\nIf you use this workflow, please cite:\n- PretextMap and PretextView tools\n- Compleasm for gene completeness assessment\n- Teloscope for telomere detection\n- Other tools as listed in the workflow\n", "report": { "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nSamtools markdup deduplication stats (if applicable)\n\n\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats\")\n```\n\n\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n## Telomere report\n\n```galaxy\nhistory_dataset_embedded(output=\"Telomere Report\")\n```\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks - Multimapping\")\n```\n\n\nWith MAPQ filtering\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot With tracks\")\n```\n\n\n" }, @@ -865,7 +865,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": "Hap2 not provided", "name": "Map parameter value", "outputs": [ @@ -1479,7 +1484,7 @@ } }, "tags": [], - "uuid": "82b7bed7-29f9-45fb-a0e9-607fdcad3656" + "uuid": "30309ff5-9842-4f92-870e-6c1c86cb7448" }, "tool_id": null, "type": "subworkflow", @@ -1545,7 +1550,7 @@ }, "1": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", "errors": null, "id": 1, "input_connections": { @@ -1574,16 +1579,16 @@ "output_name": "output" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", "tool_shed_repository": { - "changeset_revision": "d3c07d270a50", + "changeset_revision": "3e27acfa4830", "name": "collection_element_identifiers", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.0.2", + "tool_version": "0.0.3", "type": "tool", "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", "when": null, @@ -1720,7 +1725,12 @@ "output_name": "text_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": null, "name": "Map parameter value", "outputs": [ @@ -1772,7 +1782,12 @@ "output_name": "text_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": null, "name": "Map parameter value", "outputs": [ @@ -1824,7 +1839,12 @@ "output_name": "text_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": null, "name": "Map parameter value", "outputs": [ @@ -1867,7 +1887,7 @@ } }, "tags": [], - "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + "uuid": "dce3c762-bf61-4c2e-9fd1-6f4e497f7e31" }, "tool_id": null, "type": "subworkflow", @@ -1877,7 +1897,7 @@ }, "25": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", "errors": null, "id": 25, "input_connections": { @@ -1890,7 +1910,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cutadapt", + "name": "library" + } + ], "label": null, "name": "Cutadapt", "outputs": [ @@ -1932,16 +1957,16 @@ "output_name": "report" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", "tool_shed_repository": { - "changeset_revision": "5d00fd7847eb", + "changeset_revision": "f6168dd17f82", "name": "cutadapt", "owner": "lparsons", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}]}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\", \"json_stats\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "5.2+galaxy1", + "tool_version": "5.2+galaxy2", "type": "tool", "uuid": "e8774c1b-de76-4199-8d6a-0e3b37625469", "when": "$(inputs.when)", @@ -2243,7 +2268,7 @@ } }, "tags": [], - "uuid": "247a97c1-a0ec-4308-9280-a2ae4a42a18c" + "uuid": "b3d247cb-e70c-4631-aaf5-3312e6beb9bf" }, "tool_id": null, "type": "subworkflow", @@ -2804,7 +2829,7 @@ }, "1": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", "errors": null, "id": 1, "input_connections": { @@ -2833,16 +2858,16 @@ "output_name": "output" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.3", "tool_shed_repository": { - "changeset_revision": "d3c07d270a50", + "changeset_revision": "3e27acfa4830", "name": "collection_element_identifiers", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.0.2", + "tool_version": "0.0.3", "type": "tool", "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", "when": null, @@ -2979,7 +3004,12 @@ "output_name": "text_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": null, "name": "Map parameter value", "outputs": [ @@ -3031,7 +3061,12 @@ "output_name": "text_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": null, "name": "Map parameter value", "outputs": [ @@ -3083,7 +3118,12 @@ "output_name": "text_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": null, "name": "Map parameter value", "outputs": [ @@ -3126,7 +3166,7 @@ } }, "tags": [], - "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + "uuid": "4a78dc6f-8f78-4d3a-8797-4550068b3e57" }, "tool_id": null, "type": "subworkflow", @@ -3149,7 +3189,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Cutadapt", + "name": "library" + } + ], "label": "Trim Hi-C reads 2", "name": "Cutadapt", "outputs": [ @@ -3218,7 +3263,12 @@ "output_name": "output" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": "False when removal is true", "name": "Map parameter value", "outputs": [ @@ -3333,7 +3383,16 @@ "output_name": "index" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool BWA-MEM2", + "name": "fastq_input" + }, + { + "description": "runtime parameter for tool BWA-MEM2", + "name": "reference_source" + } + ], "label": null, "name": "BWA-MEM2", "outputs": [ @@ -3592,7 +3651,16 @@ "output_name": "Has multiple samples" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Samtools merge", + "name": "bed_file" + }, + { + "description": "runtime parameter for tool Samtools merge", + "name": "headerbam" + } + ], "label": null, "name": "Samtools merge", "outputs": [ @@ -3803,7 +3871,7 @@ }, "19": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3", "errors": null, "id": 19, "input_connections": { @@ -3812,7 +3880,12 @@ "output_name": "dedup_pairs_stats" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool MultiQC", + "name": "image_content_input" + } + ], "label": "Pairtools Multiqc", "name": "MultiQC", "outputs": [ @@ -3886,16 +3959,16 @@ "output_name": "stats" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy3", "tool_shed_repository": { - "changeset_revision": "26ee5e11ecbe", + "changeset_revision": "862943c10425", "name": "multiqc", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": true, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"pairtools\", \"__current_case__\": 39, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"Hi-C alignements to Scaffold stats\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": true, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"pairtools\", \"__current_case__\": 40, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"Hi-C alignements to Scaffold stats\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.33+galaxy0", + "tool_version": "1.33+galaxy3", "type": "tool", "uuid": "66905684-e6a1-4d2a-91ad-4809ca5e864a", "when": null, @@ -3975,7 +4048,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"bamfile\": {\"__class__\": \"RuntimeValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "1.22+galaxy2", "type": "tool", @@ -4174,7 +4247,7 @@ } }, "tags": [], - "uuid": "c7542d02-e14a-48e5-b968-12782e345189" + "uuid": "a81325c9-2921-4da7-b7fc-7a52324c98e9" }, "tool_id": null, "type": "subworkflow", @@ -4317,7 +4390,7 @@ }, "33": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", "errors": null, "id": 33, "input_connections": { @@ -4362,16 +4435,16 @@ "output_name": "stats" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", "tool_shed_repository": { - "changeset_revision": "0fe699ced54f", + "changeset_revision": "10dc0f5a82e2", "name": "gfastats", "owner": "bgruening", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"coordinates\", \"__current_case__\": 1, \"out_coord\": \"g\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "1.3.11+galaxy1", + "tool_version": "1.3.11+galaxy2", "type": "tool", "uuid": "7ef0994f-1ebf-4d9d-8799-cd6f42cb0c0c", "when": null, @@ -4385,7 +4458,7 @@ }, "34": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0", "errors": null, "id": 34, "input_connections": { @@ -4398,7 +4471,16 @@ "output_name": "data_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map with minimap2", + "name": "fastq_input" + }, + { + "description": "runtime parameter for tool Map with minimap2", + "name": "reference_source" + } + ], "label": null, "name": "Map with minimap2", "outputs": [ @@ -4418,16 +4500,16 @@ "output_name": "alignment_output" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.30+galaxy0", "tool_shed_repository": { - "changeset_revision": "539de907fd99", + "changeset_revision": "3faf9a2bf58d", "name": "minimap2", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": true}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-hifi\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"b\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"end_bonus\": \"0\", \"score_N\": \"1\", \"no_end_flt\": true, \"jump_min_match\": \"3\", \"end_seed_pen\": \"6\", \"cap_sw_mem\": \"100m\", \"cap_kalloc\": \"500m\"}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-hifi\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false, \"copy_comments\": false, \"ds_tag\": false, \"secondary_seq\": false, \"two_io_threads\": false, \"seed\": null}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null, \"rmq_inner\": \"1000\", \"no_hash_name\": false, \"pairing\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.28+galaxy2", + "tool_version": "2.30+galaxy0", "type": "tool", "uuid": "9c9cf464-20c0-457f-9c37-8a7018546bd1", "when": null, @@ -5126,7 +5208,7 @@ } }, "tags": [], - "uuid": "7fc536e9-da91-49ef-b42c-32ae1d0ac00c" + "uuid": "a61be640-5bb7-44cb-9a1a-5ce042e24ff7" }, "tool_id": null, "type": "subworkflow", @@ -5142,7 +5224,7 @@ }, "36": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "errors": null, "id": 36, "input_connections": { @@ -5186,16 +5268,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "056f86469460", + "changeset_revision": "bd07b0d0f568", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.3+galaxy0", + "tool_version": "0.2.4+galaxy0", "type": "tool", "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", "when": null, @@ -5203,7 +5285,7 @@ }, "37": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "errors": null, "id": 37, "input_connections": { @@ -5243,16 +5325,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "056f86469460", + "changeset_revision": "bd07b0d0f568", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.3+galaxy0", + "tool_version": "0.2.4+galaxy0", "type": "tool", "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", "when": null, @@ -5260,7 +5342,7 @@ }, "38": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "errors": null, "id": 38, "input_connections": { @@ -5289,16 +5371,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "056f86469460", + "changeset_revision": "bd07b0d0f568", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.3+galaxy0", + "tool_version": "0.2.4+galaxy0", "type": "tool", "uuid": "5a5244b8-55c5-454f-89a0-34e156f18a98", "when": null, @@ -5306,7 +5388,7 @@ }, "39": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "errors": null, "id": 39, "input_connections": { @@ -5339,16 +5421,16 @@ "output_name": "pretext_map_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "056f86469460", + "changeset_revision": "bd07b0d0f568", "name": "pretext_map", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.3+galaxy0", + "tool_version": "0.2.4+galaxy0", "type": "tool", "uuid": "e70fec59-6087-46ec-964c-aece775f69ca", "when": null, @@ -5450,7 +5532,7 @@ }, "42": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "errors": null, "id": 42, "input_connections": { @@ -5495,16 +5577,16 @@ "output_name": "out_file1" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "tool_shed_repository": { - "changeset_revision": "aff5135563c6", + "changeset_revision": "61f9ddbc63ca", "name": "column_maker", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"abs(int(c3)-int(c2))\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.1", + "tool_version": "2.1+galaxy0", "type": "tool", "uuid": "659f271c-28fd-4b7d-807a-06c7189b159d", "when": null, @@ -5531,7 +5613,16 @@ "output_name": "Has multiple samples" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Samtools merge", + "name": "bed_file" + }, + { + "description": "runtime parameter for tool Samtools merge", + "name": "headerbam" + } + ], "label": null, "name": "Samtools merge", "outputs": [ @@ -5612,7 +5703,7 @@ }, "45": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", "errors": null, "id": 45, "input_connections": { @@ -5641,16 +5732,16 @@ "output_name": "pretext_snap_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", "tool_shed_repository": { - "changeset_revision": "ff02cf8f66f0", + "changeset_revision": "c4fb391275a0", "name": "pretext_snapshot", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.0.5+galaxy1", + "tool_version": "0.0.7+galaxy0", "type": "tool", "uuid": "f453794e-4045-4602-9f49-26abf7f1426f", "when": null, @@ -5658,7 +5749,7 @@ }, "46": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", "errors": null, "id": 46, "input_connections": { @@ -5687,16 +5778,16 @@ "output_name": "pretext_snap_out" } }, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.7+galaxy0", "tool_shed_repository": { - "changeset_revision": "ff02cf8f66f0", + "changeset_revision": "c4fb391275a0", "name": "pretext_snapshot", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.0.5+galaxy1", + "tool_version": "0.0.7+galaxy0", "type": "tool", "uuid": "533b33d8-3a3b-480a-9978-1526d65606c5", "when": null, @@ -6241,7 +6332,12 @@ "output_name": "text_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": "False if Q telomere track is empty", "name": "Map parameter value", "outputs": [ @@ -6287,7 +6383,12 @@ "output_name": "text_param" } }, - "inputs": [], + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], "label": "False if P telomere track is empty", "name": "Map parameter value", "outputs": [ @@ -6566,7 +6667,7 @@ }, "64": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "errors": null, "id": 64, "input_connections": { @@ -6589,16 +6690,16 @@ "top": 1950 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1+galaxy0", "tool_shed_repository": { - "changeset_revision": "aff5135563c6", + "changeset_revision": "61f9ddbc63ca", "name": "column_maker", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"c2-1\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.1", + "tool_version": "2.1+galaxy0", "type": "tool", "uuid": "28ba3827-13c9-431f-b02c-01904a6f0577", "when": null, @@ -7509,7 +7610,7 @@ } }, "tags": [], - "uuid": "51640fb0-0e97-4a6b-baf6-234fc13400ba", - "version": 2, - "release": "2.3" -} + "uuid": "37c14c66-17cf-4cf8-b1f0-a106f44799e6", + "version": 1, + "release": "2.4" +} \ No newline at end of file