diff --git a/workflows/VGP-assembly-v2/post-curation-processing/.dockstore.yml b/workflows/VGP-assembly-v2/post-curation-processing/.dockstore.yml new file mode 100644 index 0000000000..7a4c4aaf16 --- /dev/null +++ b/workflows/VGP-assembly-v2/post-curation-processing/.dockstore.yml @@ -0,0 +1,11 @@ +version: 1.2 +workflows: +- name: main + subclass: Galaxy + publish: true + primaryDescriptorPath: /Post_Curation.ga + testParameterFiles: + - /Post_Curation-tests.yml + authors: + - name: Delphine Lariviere + orcid: 0000-0001-6421-3484 diff --git a/workflows/VGP-assembly-v2/post-curation-processing/CHANGELOG.md b/workflows/VGP-assembly-v2/post-curation-processing/CHANGELOG.md new file mode 100644 index 0000000000..c2db14275b --- /dev/null +++ b/workflows/VGP-assembly-v2/post-curation-processing/CHANGELOG.md @@ -0,0 +1,13 @@ +# Changelog + +## [0.1] - 2026-03-18 + +### Added +- Initial release of the Post Curation workflow +- Splits curated AGP and combined FASTA by haplotype +- Assigns chromosome names based on scaffold size +- Renames and reorients hap2 chromosomes to match hap1 using mashmap +- Generates Compleasm gene annotation tracks +- Generates Hi-C contact maps (Pretext) with coverage, telomere, gap, and gene tracks +- Supports sex chromosome labeling (Z/W) +- Optional Hi-C read trimming, duplicate removal, and HiFi adapter removal diff --git a/workflows/VGP-assembly-v2/post-curation-processing/Post_Curation-tests.yml b/workflows/VGP-assembly-v2/post-curation-processing/Post_Curation-tests.yml new file mode 100644 index 0000000000..dbe295a5de --- /dev/null +++ b/workflows/VGP-assembly-v2/post-curation-processing/Post_Curation-tests.yml @@ -0,0 +1,150 @@ +- doc: Test post-curation processing with synthetic data + job: + Species Name: Test_species + Assembly Name: testAsm + Curated AGP file: + class: File + location: https://zenodo.org/records/19101571/files/test_curation.agp + filetype: tabular + hashes: + - hash_function: SHA-1 + hash_value: 5185f176d2d92c10e02f26e578603aec0c1baca4 + Fasta file with both haplotypes: + class: File + location: https://zenodo.org/records/19101571/files/test_assembly.fasta + filetype: fasta + hashes: + - hash_function: SHA-1 + hash_value: f2c93e14f10f9525d120a942316203d213805ba4 + Database for Compleasm Genes: vertebrata_odb10 + Hi-C reads: + class: Collection + collection_type: list:paired + elements: + - class: Collection + collection_type: paired + identifier: HiC_set_1 + elements: + - identifier: forward + class: File + location: https://zenodo.org/records/19101571/files/HiC_forward.fastqsanger.gz + filetype: fastqsanger.gz + hashes: + - hash_function: SHA-1 + hash_value: 5e531589f9248ccf7c4d677edffc060683167dba + - identifier: reverse + class: File + location: https://zenodo.org/records/19101571/files/HiC_reverse.fastqsanger.gz + filetype: fastqsanger.gz + hashes: + - hash_function: SHA-1 + hash_value: aaaeec9daf27cfee04ee46feb28c3d202b21a86c + "Trim the Hi-C data?": false + "Remove duplicated Hi-C reads?": true + PacBio reads: + class: Collection + collection_type: list + elements: + - class: File + identifier: PacBio_set_1 + location: https://zenodo.org/records/19101571/files/PacBio_reads.fastq.gz + filetype: fastqsanger.gz + hashes: + - hash_function: SHA-1 + hash_value: 9c7c1af0887a9825d5391c783127aaa7321b6401 + "Remove adapters from HiFi reads?": false + "Generate Gene tracks with Compleasm?": true + Canonical telomeric pattern: TTAGGG + Telomere patterns to explore: "TTAGGG,CCCTAA" + Minimum Mapping Quality: 10 + Bin Size for BigWig files: 100 + "Generate high resolution Hi-C maps?": false + outputs: + # --- Curation results --- + Corrected AGP: + asserts: + - has_text: + text: "scaffold_1.H1" + - has_text: + text: "scaffold_5.H1" + Curated Hap1: + asserts: + - has_size: + value: 270000 + delta: 50000 + Curated Hap2: + asserts: + - has_size: + value: 410000 + delta: 50000 + Hap1 AGP: + asserts: + - has_text: + text: "Scaffold_1" + - has_text: + text: "Hap_1" + # --- Chromosome assignment: correct number and sex chroms --- + Chromosome mapping Hap1: + asserts: + - has_text: + text: "SUPER_1" + - has_n_lines: + n: 4 + Chromosome mapping Hap2: + asserts: + - has_text: + text: "SUPER_1" + - has_text: + text: "SUPER_Z" + - has_text: + text: "SUPER_W" + - has_n_lines: + n: 5 + # --- Rename/reorient: verify both RENAME and RVCP happened --- + Reorientation and renaming instructions: + asserts: + - has_text: + text: "RENAME" + - has_text: + text: "RVCP" + - has_n_lines: + n: 4 + # --- Orientation mapping: inversion detected --- + Hap1 Hap2 orientation mapping: + asserts: + - has_text: + text: "Main Orientation" + - has_text: + text: "-" + # --- No missing sequences in mashmap --- + Sequences missing in mashmap: + asserts: + - has_n_lines: + n: 0 + # --- Telomere detection (Hap1): 5 telomeres found --- + Hap1 Telomere Report: + asserts: + - has_text: + text: "Total paths:\t4" + - has_text: + text: "Total telomeres:\t5" + - has_text: + text: "Two telomeres:\t2" + - has_text: + text: "One telomere:\t1" + # --- Telomere detection (Hap2): paths include sex chroms --- + Hap2 Telomere Report: + asserts: + - has_text: + text: "Total paths:\t5" + - has_text: + text: "SUPER_Z" + - has_text: + text: "SUPER_W" + # --- Hi-C dedup stats exist with real data --- + "Hap1 Hi-C duplication stats on Curated Assembly: Raw": + asserts: + - has_text: + text: "cis" + - has_text: + text: "chrom_freq" diff --git a/workflows/VGP-assembly-v2/post-curation-processing/Post_Curation.ga b/workflows/VGP-assembly-v2/post-curation-processing/Post_Curation.ga new file mode 100644 index 0000000000..75d920e301 --- /dev/null +++ b/workflows/VGP-assembly-v2/post-curation-processing/Post_Curation.ga @@ -0,0 +1,14382 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "Post-curation processing workflow for VGP assemblies. Takes a curated AGP file and combined haplotype FASTA, splits by haplotype, applies curation, assigns chromosome names, renames and reorients hap2 to match hap1, then generates QC outputs including Compleasm, Pretext maps, telomere analysis, and coverage tracks.", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + }, + { + "class": "Organization", + "name": "IWC", + "url": "https://github.com/galaxyproject/iwc" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Post-curation assembly processing and evaluation", + "readme": "# Post-curation assembly processing and evaluation\n\nThis workflow performs post-curation processing and evaluation for VGP assemblies. It takes a curated AGP file and combined haplotype FASTA, splits by haplotype, applies curation, assigns chromosome names, renames and reorients hap2 to match hap1, and generates QC outputs including Compleasm results, Pretext maps, telomere analysis, and coverage tracks.\n\n## Inputs\n\n### Required Inputs\n\n1. **Species Name** [text] - Species identifier\n2. **Assembly Name** [text] - Assembly identifier\n3. **Curated AGP file** [tabular] - Generated by PretextView after manual curation (PretextView AGP v2.1 format with haplotype labels)\n4. **Fasta file with both haplotypes** [fasta] - Generated by the pre-curation workflow, containing both haplotypes in a single file\n5. **Database for Compleasm Genes** [text] - Compleasm lineage dataset (e.g., vertebrata_odb10, primates_odb10)\n6. **Hi-C reads** [list:paired] - Paired collection of Hi-C sequencing data\n7. **PacBio reads** [list] - Collection of PacBio HiFi reads\n\n### Processing Options\n\n8. **Generate Gene tracks with Compleasm?** [boolean] - Enable/disable Compleasm gene annotation tracks\n9. **Trim the Hi-C data?** [boolean] - Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\"\n10. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C data\n11. **Remove adapters from HiFi reads?** [boolean] - Select no if using HiFi reads trimmed in a previous workflow\n12. **Generate high resolution Hi-C maps?** [boolean] - Generate high resolution Pretext maps\n\n### Analysis Parameters\n\n13. **Canonical telomeric pattern** [text] - Default: TTAGGG (for vertebrate genomes)\n14. **Telomere patterns to explore** [text] - Telomere repeat patterns to search for (comma-separated, IUPAC allowed)\n15. **Minimum Mapping Quality** [integer] - Minimum mapping score for Hi-C alignments. Default: 10\n16. **Bin Size for BigWig files** [integer] - Bin size for coverage tracks. Default: 100\n\n### Haplotype Naming\n\n17. **Name Haplotype 1** [text] - Label for haplotype 1 (used to prefix output names)\n18. **Name Haplotype 2** [text] - Label for haplotype 2 (used to prefix output names)\n\n## Outputs\n\n### Assembly Summary\n\n- **Assembly information** - Assembly summary information\n\n### Curation Results\n\n- **Corrected AGP** - AGP file with corrections applied\n- **Curated Hap1** - Curated haplotype 1 FASTA\n- **Curated Hap2** - Curated haplotype 2 FASTA\n- **Hap1 AGP** - Haplotype 1 AGP\n- **Hap2 Unlocs no hap dups AGP** - Haplotype 2 AGP without haplotypic duplicates in unlocalized scaffolds\n- **Hap1 Unlocs no hap dups AGP** - Haplotype 1 AGP without haplotypic duplicates in unlocalized scaffolds\n- **Hap1 Unlocs** - Haplotype 1 unlocalized scaffolds\n- **Hap2 Unlocs** - Haplotype 2 unlocalized scaffolds\n- **Hap1 Haplotigs** - Haplotype 1 haplotigs\n- **Hap2 AGP** - Haplotype 2 AGP (primary AGP for haplotype 2)\n\n### Chromosome Assignment\n\n- **Chromosome mapping Hap1** - Scaffold to chromosome mapping for haplotype 1 (SUPER_N naming)\n- **Chromosome mapping Hap2** - Scaffold to chromosome mapping for haplotype 2\n- **Chromosome level Hap2** - Chromosome-level haplotype 2 FASTA\n\n### Rename and Reorient\n\n- **Mashmap for Hap2 sync** - Mashmap alignment between haplotypes at chromosome level (from curation subworkflow)\n- **Mashmap Chromosome level** - Mashmap alignment between curated haplotypes\n- **Hap1 Hap2 orientation mapping** - Orientation mapping between haplotypes\n- **Reorientation and renaming instructions** - Instructions for renaming and reorienting hap2\n- **Sequences missing in mashmap** - Sequences not aligned by mashmap\n\n### Visualization\n\n- **JBrowse2 without Gene tracks** - JBrowse2 visualization without gene annotation tracks\n- **JBrowse2 with Gene tracks** - JBrowse2 visualization with Compleasm gene annotation tracks\n- **Hi-C maps for each haplotype** - Combined Hi-C contact maps (MAPQ filtered)\n- **Hi-C maps for each haplotype - Multimapping** - Combined Hi-C contact maps (multimapping)\n\n### Haplotype 1 QC\n\n- **Hap1 Telomere Report** - Telomere analysis report\n- **Hap1 terminal telomeres** - Terminal telomere positions\n- **Hap1 P telomeres BED** - P-arm telomere positions\n- **Hap1 Q telomeres BED** - Q-arm telomere positions\n- **Hap1 Gaps BED** - Assembly gaps BED file\n- **Hap1 Gaps BEDgraph** - Assembly gaps bedgraph\n- **Hap1 Genes track** - Compleasm gene annotation track\n- **Hap1 Compleasm Summary** - Compleasm completeness summary\n- **Hap1 miniprot** - Miniprot protein-to-genome alignments\n- **Hap1 BigWig Coverage** - PacBio read coverage track\n- **Hap1 Coverage Gaps Track** - Coverage gaps track\n- **Hap1 Coverage gap BED for JBrowse2** - Coverage gaps BED for JBrowse2\n- **Hap1 Merged HiFi Alignments** - Merged PacBio HiFi alignments\n- **Hap1 Merged Hi-C Alignments on Curated Assembly** - Merged Hi-C alignments\n- **Hap1 Hi-C alignments on Curated Assembly** - Hi-C alignments\n- **Hap1 Hi-C duplication stats on Curated Assembly** - Hi-C duplication statistics\n- **Hap1 Hi-C duplication stats on Curated Assembly: Raw** - Raw duplication statistics\n- **Hap1 Hi-C duplication stats on Curated Assembly: MultiQC** - MultiQC duplication report\n- **Hap1 Pairtools MultiQC Stats on Curated Assembly** - Pairtools MultiQC statistics\n- **Hap1 Pairtools MultiQC on Curated Assembly: Plots** - Pairtools MultiQC plots\n- **Hap1 Pretext All tracks** - Pretext map with all tracks (MAPQ filtered)\n- **Hap1 Pretext All tracks - Multimapping** - Pretext map with all tracks (multimapping)\n- **Hap1 Pretext Snapshot** - Pretext snapshot for haplotype 1\n- **Hap1 Pretext Snapshot - Multimapping** - Pretext snapshot with tracks (multimapping)\n\n### Haplotype 2 QC\n\n- **Hap2 Telomere Report** - Telomere analysis report\n- **Hap2 terminal telomeres** - Terminal telomere positions\n- **Hap2 P telomeres BED** - P-arm telomere positions\n- **Hap2 Q telomeres BED** - Q-arm telomere positions\n- **Hap2 Gaps BED** - Assembly gaps BED file\n- **Hap2 Gaps BEDgraph** - Assembly gaps bedgraph\n- **Hap2 Genes track** - Compleasm gene annotation track\n- **Hap2 Compleasm Summary** - Compleasm completeness summary\n- **Hap2 miniprot** - Miniprot protein-to-genome alignments\n- **Hap2 BigWig Coverage** - PacBio read coverage track\n- **Hap2 Coverage Gaps Track** - Coverage gaps track\n- **Hap2 Coverage gap BED for JBrowse2** - Coverage gaps BED for JBrowse2\n- **Hap2 Merged HiFi Alignments** - Merged PacBio HiFi alignments\n- **Hap2 Merged Hi-C Alignments on Curated Assembly** - Merged Hi-C alignments\n- **Hap2 Hi-C alignments on Curated Assembly** - Hi-C alignments\n- **Hap2 Hi-C duplication stats on Curated Assembly** - Hi-C duplication statistics\n- **Hap2 Hi-C duplication stats on Curated Assembly: Raw** - Raw duplication statistics\n- **Hap2 Hi-C duplication stats on Curated Assembly: MultiQC** - MultiQC duplication report\n- **Hap2 Pairtools MultiQC Stats on Curated Assembly** - Pairtools MultiQC statistics\n- **Hap2 Pairtools MultiQC on Curated Assembly: Plots** - Pairtools MultiQC plots\n- **Hap2 Pretext All tracks** - Pretext map with all tracks (MAPQ filtered)\n- **Hap2 Pretext All tracks - Multimapping** - Pretext map with all tracks (multimapping)\n- **Hap2 Pretext Snapshot** - Pretext snapshot for haplotype 2\n- **Hap2 Pretext Snapshot - Multimapping** - Pretext snapshot with tracks (multimapping)\n", + "report": { + "markdown": "# Post-curation assembly processing and evaluation\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly information\")\n```\n\n## Hap2 Rename and Reorient\n\n\n### Orientation mapping\n\n```galaxy\nhistory_dataset_as_table(output=\"Hap1 Hap2 orientation mapping\")\n```\n\n### Reorientation and renaming instructions\n\n```galaxy\nhistory_dataset_as_table(output=\"Reorientation and renaming instructions\")\n```\n\n### Sequences missing in mashmap\n\n```galaxy\nhistory_dataset_embedded(output=\"Sequences missing in mashmap\")\n```\n\n## Pretext Snapshots\n\n\nWith multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Hi-C maps for each haplotype - Multimapping\")\n```\n\n\nWith MAPQ filtering\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Hi-C maps for each haplotype\")\n```\n\n\n## Hi-C Duplication Stats\n\n### Haplotype 1\n\n\n```galaxy\nhistory_dataset_embedded(output=\"Hap1 Hi-C duplication stats on Curated Assembly: MultiQC\")\n```\n\n### Haplotype 2\n\n\n```galaxy\nhistory_dataset_embedded(output=\"Hap2 Hi-C duplication stats on Curated Assembly: MultiQC\")\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Species Name" + } + ], + "label": "Species Name", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 0, + "top": 133.56714561678908 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "c2f785f3-0ef6-480f-bfe1-b2c76a04048a", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Assembly Name" + } + ], + "label": "Assembly Name", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 11.688889166010178, + "top": 225.48148062578323 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "9bf4e764-e9e6-466f-8748-28c5d4726022", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "Generated by PretextView after Manual Curation", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "Generated by PretextView after Manual Curation", + "name": "Curated AGP file" + } + ], + "label": "Curated AGP file", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 17.07950172777408, + "top": 357.3420432682606 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"agp\", \" tabular\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "6d7032b6-b46c-41cf-bca2-e7f072ae6bfb", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Generate Gene tracks with Compleasm?" + } + ], + "label": "Generate Gene tracks with Compleasm?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 35.60837942384908, + "top": 471.3479626054751 + }, + "tool_id": null, + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "380ebb3b-6401-46a4-8474-feae5cfdeb97", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "Generated by the pre-curation workflow.", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "Generated by the pre-curation workflow.", + "name": "Fasta file with both haplotypes" + } + ], + "label": "Fasta file with both haplotypes", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 63.22733808272641, + "top": 570.029110122108 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\", \" fasta.gz\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "2d922f8c-80fe-46d1-a771-569a1a9e14bc", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Database for Compleasm Genes" + } + ], + "label": "Database for Compleasm Genes", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 92.2269696208844, + "top": 693.4771510852246 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "afeeb8ac-c97c-4957-8580-aefa187ea1a4", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 100.9704912792228, + "top": 793.5370895350214 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "ce39d38d-7d79-4478-95fd-e6b394c2a7f3", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks \"noisy\".", + "name": "Trim the Hi-C data?" + } + ], + "label": "Trim the Hi-C data?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 118.18720992549103, + "top": 884.4434833481753 + }, + "tool_id": null, + "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "52e07b89-bd2f-4ebd-813c-5d01f9fbb5e5", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 8, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Remove duplicated Hi-C reads?" + } + ], + "label": "Remove duplicated Hi-C reads?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 138.05168199291575, + "top": 1005.8282357969524 + }, + "tool_id": null, + "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "42bdefe3-b57e-4a9b-8c47-53eb01dc7405", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 9, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "PacBio reads" + } + ], + "label": "PacBio reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 160.4757937992113, + "top": 1134.7877731105486 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "ad6667e1-a8ec-4d27-b2f0-3f23a795ee0c", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "Select no if you are using the HiFi reads trimmed in a previous workflow. ", + "content_id": null, + "errors": null, + "id": 10, + "input_connections": {}, + "inputs": [ + { + "description": "Select no if you are using the HiFi reads trimmed in a previous workflow. ", + "name": "Remove adapters from HiFi reads?" + } + ], + "label": "Remove adapters from HiFi reads?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 201.44807700184856, + "top": 1259.6123370204832 + }, + "tool_id": null, + "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "26c7705f-0f6c-4794-9a35-f8aa864e3144", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "The default value is set for vertebrate genomes (TTAGGG).", + "content_id": null, + "errors": null, + "id": 11, + "input_connections": {}, + "inputs": [ + { + "description": "The default value is set for vertebrate genomes (TTAGGG).", + "name": "Canonical telomeric pattern" + } + ], + "label": "Canonical telomeric pattern", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 255.02756549550435, + "top": 1389.2146313154865 + }, + "tool_id": null, + "tool_state": "{\"default\": \"TTAGGG\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "a2be10a8-e048-4c2d-b8a4-22e650d4d30a", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "Comma-separated, IUPAC allowed.", + "content_id": null, + "errors": null, + "id": 12, + "input_connections": {}, + "inputs": [ + { + "description": "Comma-separated, IUPAC allowed.", + "name": "Telomere patterns to explore" + } + ], + "label": "Telomere patterns to explore", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 304.9057967828626, + "top": 1509.4218645555327 + }, + "tool_id": null, + "tool_state": "{\"default\": \"TTAGGG,CCCTAA\", \"multiple\": false, \"validators\": [{\"message\": \"Please enter comma separated patterns with no blank spaces.\", \"expression\": \"^\\\\S+$\", \"negate\": false, \"type\": \"regex\"}], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "35c5d43d-133c-4ee3-8257-37de861b2f91", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10 ", + "content_id": null, + "errors": null, + "id": 13, + "input_connections": {}, + "inputs": [ + { + "description": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 10 ", + "name": "Minimum Mapping Quality" + } + ], + "label": "Minimum Mapping Quality", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 189.76476248905973, + "top": 1661.9659506040184 + }, + "tool_id": null, + "tool_state": "{\"default\": 10, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "5e4a1781-47b0-4632-895f-88c0efceccc0", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "Select bin size for the coverage tracks. Default: 100", + "content_id": null, + "errors": null, + "id": 14, + "input_connections": {}, + "inputs": [ + { + "description": "Select bin size for the coverage tracks. Default: 100", + "name": "Bin Size for BigWig files" + } + ], + "label": "Bin Size for BigWig files", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 220.3523705095107, + "top": 1767.9766509299516 + }, + "tool_id": null, + "tool_state": "{\"default\": 100, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "4f289681-a40d-486b-8fd1-12eeee974595", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 15, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Generate high resolution Hi-C maps?" + } + ], + "label": "Generate high resolution Hi-C maps?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 247.5711984709536, + "top": 1863.9883302625426 + }, + "tool_id": null, + "tool_state": "{\"default\": false, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "50dec25c-e80a-4bed-8e07-996cc64487f0", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 16, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name Haplotype 1" + } + ], + "label": "Name Haplotype 1", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 318.07382201666735, + "top": 1973.0138117574236 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Hap1\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "5d0019ff-081d-4b5e-b18a-4c31e1b21205", + "when": null, + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 17, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Name Haplotype 2" + } + ], + "label": "Name Haplotype 2", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 365.83587727830303, + "top": 2083.2097672268546 + }, + "tool_id": null, + "tool_state": "{\"default\": \"Hap2\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "0ab6e585-5397-4905-a90a-6a1c1c556b48", + "when": null, + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "errors": null, + "id": 18, + "input_connections": { + "components_1|param_type|component_value": { + "id": 0, + "output_name": "output" + }, + "components_3|param_type|component_value": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": "Assembly informations", + "name": "Compose text parameter value", + "outputs": [ + { + "name": "out1", + "type": "expression.json" + } + ], + "position": { + "left": 370.0718608980522, + "top": 114.62511206511644 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1", + "tool_shed_repository": { + "changeset_revision": "e188c9826e0f", + "name": "compose_text_param", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"components\": [{\"__index__\": 0, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \"Species: \"}}, {\"__index__\": 1, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": \", ToLID: \"}}, {\"__index__\": 3, \"param_type\": {\"select_param_type\": \"text\", \"__current_case__\": 0, \"component_value\": {\"__class__\": \"ConnectedValue\"}}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.1", + "type": "tool", + "uuid": "2376c969-5d82-419b-8cb0-ea20258e2d47", + "when": null, + "workflow_outputs": [ + { + "label": "Assembly information", + "output_name": "out1", + "uuid": "542ddacb-9a97-4437-88b8-d18d18697190" + } + ] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 19, + "input_connections": { + "input_param_type|input_param": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": "True when no gene track generated", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 2842.5188598632812, + "top": 1373.4002280319132 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2f5c0e69-5d94-4273-ab43-923f7b4b4359", + "when": null, + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "id": 20, + "input_connections": { + "Combined Fasta Files": { + "id": 4, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Curated AGP File": { + "id": 2, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Curation Processing", + "outputs": [], + "position": { + "left": 765.947566173267, + "top": 946.7286905546356 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Curation Processing", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Curated AGP File" + } + ], + "label": "Curated AGP File", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 678.6457950767444 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"agp\", \"tabular\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ea05d047-71af-4bf1-bdfb-b490628da1a8", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Combined Fasta Files" + } + ], + "label": "Combined Fasta Files", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 4.1171875, + "top": 900.8205018974656 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "458b8bc8-3faa-495c-b65a-f6c893ef8cd0", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/vgp_split_agp/vgp_split_agp/1.1+galaxy0", + "errors": null, + "id": 2, + "input_connections": { + "agp": { + "id": 0, + "output_name": "output" + }, + "fasta": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "VGP Split AGP", + "outputs": [ + { + "name": "corrected_agp", + "type": "tabular" + }, + { + "name": "hap1_agp", + "type": "tabular" + }, + { + "name": "hap1_unlocs_no_hapdups", + "type": "tabular" + }, + { + "name": "hap1_haplotigs", + "type": "tabular" + }, + { + "name": "hap2_agp", + "type": "tabular" + }, + { + "name": "hap2_unlocs_no_hapdups", + "type": "tabular" + }, + { + "name": "hap2_haplotigs", + "type": "tabular" + } + ], + "position": { + "left": 316.19748538346533, + "top": 288.42998223393886 + }, + "post_job_actions": { + "RenameDatasetActioncorrected_agp": { + "action_arguments": { + "newname": "Corrected AGP" + }, + "action_type": "RenameDatasetAction", + "output_name": "corrected_agp" + }, + "RenameDatasetActionhap1_agp": { + "action_arguments": { + "newname": "Hap1 AGP" + }, + "action_type": "RenameDatasetAction", + "output_name": "hap1_agp" + }, + "RenameDatasetActionhap1_haplotigs": { + "action_arguments": { + "newname": "Hap1 Haplotigs" + }, + "action_type": "RenameDatasetAction", + "output_name": "hap1_haplotigs" + }, + "RenameDatasetActionhap1_unlocs_no_hapdups": { + "action_arguments": { + "newname": "Hap2 AGP" + }, + "action_type": "RenameDatasetAction", + "output_name": "hap1_unlocs_no_hapdups" + }, + "RenameDatasetActionhap2_agp": { + "action_arguments": { + "newname": "Hap2 AGP" + }, + "action_type": "RenameDatasetAction", + "output_name": "hap2_agp" + }, + "RenameDatasetActionhap2_haplotigs": { + "action_arguments": { + "newname": "Hap2 Haplotigs" + }, + "action_type": "RenameDatasetAction", + "output_name": "hap2_haplotigs" + }, + "RenameDatasetActionhap2_unlocs_no_hapdups": { + "action_arguments": { + "newname": "Hap2 Unlocs" + }, + "action_type": "RenameDatasetAction", + "output_name": "hap2_unlocs_no_hapdups" + }, + "TagDatasetActioncorrected_agp": { + "action_arguments": { + "tags": "corrected_agp" + }, + "action_type": "TagDatasetAction", + "output_name": "corrected_agp" + }, + "TagDatasetActionhap1_agp": { + "action_arguments": { + "tags": "hap1_agp" + }, + "action_type": "TagDatasetAction", + "output_name": "hap1_agp" + }, + "TagDatasetActionhap1_haplotigs": { + "action_arguments": { + "tags": "hap1_haplotigs" + }, + "action_type": "TagDatasetAction", + "output_name": "hap1_haplotigs" + }, + "TagDatasetActionhap1_unlocs_no_hapdups": { + "action_arguments": { + "tags": "hap1_unlocs" + }, + "action_type": "TagDatasetAction", + "output_name": "hap1_unlocs_no_hapdups" + }, + "TagDatasetActionhap2_agp": { + "action_arguments": { + "tags": "hap2_agp" + }, + "action_type": "TagDatasetAction", + "output_name": "hap2_agp" + }, + "TagDatasetActionhap2_haplotigs": { + "action_arguments": { + "tags": "hap2_haplotigs" + }, + "action_type": "TagDatasetAction", + "output_name": "hap2_haplotigs" + }, + "TagDatasetActionhap2_unlocs_no_hapdups": { + "action_arguments": { + "tags": "hap2_unlocs" + }, + "action_type": "TagDatasetAction", + "output_name": "hap2_unlocs_no_hapdups" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/vgp_split_agp/vgp_split_agp/1.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "da61829dc3be", + "name": "vgp_split_agp", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"agp\": {\"__class__\": \"ConnectedValue\"}, \"fasta\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1+galaxy0", + "type": "tool", + "uuid": "24cc494f-b44c-4d29-8d28-8242ae95c69a", + "when": null, + "workflow_outputs": [ + { + "label": "Hap1 Unlocs", + "output_name": "hap1_unlocs_no_hapdups", + "uuid": "df1ccbf7-05aa-48a4-8968-2be44b29ad07" + }, + { + "label": "Hap1 Haplotigs", + "output_name": "hap1_haplotigs", + "uuid": "a6372e69-e85b-41e6-ac1b-638a71506bef" + }, + { + "label": "Hap2 Unlocs", + "output_name": "hap2_unlocs_no_hapdups", + "uuid": "403170e8-da7e-4db6-a7e3-c22b48c1cd0a" + }, + { + "label": "Hap2 AGP", + "output_name": "hap2_agp", + "uuid": "f4590239-37ea-4e1c-aafd-cd2b8eb98c69" + }, + { + "label": "Corrected AGP", + "output_name": "corrected_agp", + "uuid": "37b000a0-f682-446e-b9c1-94fee6cb2234" + }, + { + "label": "Hap1 AGP", + "output_name": "hap1_agp", + "uuid": "2369c6e2-09aa-4951-b604-ef32fe5072f7" + } + ] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "hap1_unlocs_no_hapdups" + } + }, + "inputs": [], + "label": "convert to agp Hap1", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 685.732662113419, + "top": 128.34166832566794 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "agp" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Hap1 Unlocs no hap dups AGP" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "hap1_unlocs_no_hapdups,name:hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4,c5,c6,c7,c8,c9\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "69e579ed-836c-45eb-9aa9-75ff0b9c8aa7", + "when": null, + "workflow_outputs": [ + { + "label": "Hap1 Unlocs no hap dups AGP", + "output_name": "out_file1", + "uuid": "bf2e1532-1263-48fe-a274-a263f9cbdf99" + } + ] + }, + "4": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "hap2_unlocs_no_hapdups" + } + }, + "inputs": [], + "label": "convert to agp Hap2", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 661.9685157655995, + "top": 642.5220492677254 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "agp" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Hap2 Unlocs no hap dups AGP" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "hap2_unlocs_no_hapdups,name:hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4,c5,c6,c7,c8,c9\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "63169800-1029-4b95-a1d4-c7caca32214e", + "when": null, + "workflow_outputs": [ + { + "label": "Hap2 Unlocs no hap dups AGP", + "output_name": "out_file1", + "uuid": "a5b33e88-d454-4326-93f2-643afe3e341b" + } + ] + }, + "5": { + "annotation": "Imposing the haplotypic agp on the original fasta to generate a curated fasta", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 5, + "input_connections": { + "input_file": { + "id": 1, + "output_name": "output" + }, + "mode_condition|agp_to_path": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Curated Fasta Hap1", + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 990.1197458501305, + "top": 280.72962499090363 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"scaffolding\", \"__current_case__\": 2, \"agp_to_path\": {\"__class__\": \"ConnectedValue\"}, \"discover_paths\": false, \"output_condition\": {\"out_format\": \"fasta.gz\", \"__current_case__\": 1, \"line_length\": null}}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "33a19aec-1b57-4952-8bc0-8c0abed82b28", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "Imposing the haplotypic agp on the original fasta to generate a curated fasta", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 6, + "input_connections": { + "input_file": { + "id": 1, + "output_name": "output" + }, + "mode_condition|agp_to_path": { + "id": 4, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Curated Fasta Hap2", + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 1006.0540910781996, + "top": 801.9800557216624 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"scaffolding\", \"__current_case__\": 2, \"agp_to_path\": {\"__class__\": \"ConnectedValue\"}, \"discover_paths\": false, \"output_condition\": {\"out_format\": \"fasta.gz\", \"__current_case__\": 1, \"line_length\": null}}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "5938c2f7-bef1-43a9-88f5-18a407fdea20", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "Sort fastas by descending sequence length hap1", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 7, + "input_connections": { + "input_file": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": "gfa to fasta Hap1", + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 1276.2998230751878, + "top": 351.59531467141784 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"RuntimeValue\"}, \"output_condition\": {\"out_format\": \"fasta.gz\", \"__current_case__\": 1, \"line_length\": null}, \"sort\": \"largest\", \"remove_terminal_gaps\": false, \"homopolymer_compress\": null, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "45b96c02-b95d-45ca-8b7c-941b4d83a3c6", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "Sort fastas by descending sequence length hap1", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 8, + "input_connections": { + "input_file": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": "gfa to fasta Hap2", + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 1278.1749579992074, + "top": 877.2939540845175 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"RuntimeValue\"}, \"output_condition\": {\"out_format\": \"fasta.gz\", \"__current_case__\": 1, \"line_length\": null}, \"sort\": \"largest\", \"remove_terminal_gaps\": false, \"homopolymer_compress\": null, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "91d64e8c-b34b-407d-97a8-987ed2214a40", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/vgp_chromosome_assignment/vgp_chromosome_assignment/1.1+galaxy0", + "errors": null, + "id": 9, + "input_connections": { + "agp": { + "id": 2, + "output_name": "hap1_unlocs_no_hapdups" + }, + "fasta": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": "Chromosome Assignment Hap1", + "name": "VGP Chromosome Assignment", + "outputs": [ + { + "name": "inter_chr", + "type": "tabular" + }, + { + "name": "chr_level_fasta", + "type": "fasta" + } + ], + "position": { + "left": 1625.5643263914037, + "top": 253.36674778965104 + }, + "post_job_actions": { + "RemoveTagDatasetActionchr_level_fasta": { + "action_arguments": { + "tags": "name:hap2" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "chr_level_fasta" + }, + "RemoveTagDatasetActioninter_chr": { + "action_arguments": { + "tags": "name:hap2" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "inter_chr" + }, + "RenameDatasetActionchr_level_fasta": { + "action_arguments": { + "newname": "Curated Hap1" + }, + "action_type": "RenameDatasetAction", + "output_name": "chr_level_fasta" + }, + "RenameDatasetActioninter_chr": { + "action_arguments": { + "newname": "Chromosome mapping Hap1" + }, + "action_type": "RenameDatasetAction", + "output_name": "inter_chr" + }, + "TagDatasetActionchr_level_fasta": { + "action_arguments": { + "tags": "hap1_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "chr_level_fasta" + }, + "TagDatasetActioninter_chr": { + "action_arguments": { + "tags": "chrom_map_hap1" + }, + "action_type": "TagDatasetAction", + "output_name": "inter_chr" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/vgp_chromosome_assignment/vgp_chromosome_assignment/1.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8926e6cd9071", + "name": "vgp_chromosome_assignment", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"agp\": {\"__class__\": \"ConnectedValue\"}, \"fasta\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1+galaxy0", + "type": "tool", + "uuid": "89bdd170-c448-4ae3-b434-0b819b1dd32e", + "when": null, + "workflow_outputs": [ + { + "label": "Curated Hap1", + "output_name": "chr_level_fasta", + "uuid": "0aceda11-7de6-4013-a2a7-2d54b809d348" + }, + { + "label": "Chromosome mapping Hap1", + "output_name": "inter_chr", + "uuid": "d72ab335-994a-4f15-8994-4ec87c6958ed" + } + ] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/vgp_chromosome_assignment/vgp_chromosome_assignment/1.1+galaxy0", + "errors": null, + "id": 10, + "input_connections": { + "agp": { + "id": 2, + "output_name": "hap2_unlocs_no_hapdups" + }, + "fasta": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": "Chromosome Assignment Hap2", + "name": "VGP Chromosome Assignment", + "outputs": [ + { + "name": "inter_chr", + "type": "tabular" + }, + { + "name": "chr_level_fasta", + "type": "fasta" + } + ], + "position": { + "left": 1631.7671238973405, + "top": 727.6144727972434 + }, + "post_job_actions": { + "RemoveTagDatasetActionchr_level_fasta": { + "action_arguments": { + "tags": "name:hap1" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "chr_level_fasta" + }, + "RemoveTagDatasetActioninter_chr": { + "action_arguments": { + "tags": "name:hap1" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "inter_chr" + }, + "RenameDatasetActionchr_level_fasta": { + "action_arguments": { + "newname": "Chromosome level Hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "chr_level_fasta" + }, + "RenameDatasetActioninter_chr": { + "action_arguments": { + "newname": "Chromosome mapping Hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "inter_chr" + }, + "TagDatasetActionchr_level_fasta": { + "action_arguments": { + "tags": "chrom_level_hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "chr_level_fasta" + }, + "TagDatasetActioninter_chr": { + "action_arguments": { + "tags": "chrom_map_hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "inter_chr" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/vgp_chromosome_assignment/vgp_chromosome_assignment/1.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8926e6cd9071", + "name": "vgp_chromosome_assignment", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"agp\": {\"__class__\": \"ConnectedValue\"}, \"fasta\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1+galaxy0", + "type": "tool", + "uuid": "a2aeb79a-2de9-481c-a431-f088f56754d6", + "when": null, + "workflow_outputs": [ + { + "label": "Chromosome mapping Hap2", + "output_name": "inter_chr", + "uuid": "14c30b04-773b-4cf9-b9d7-237e0fa55983" + }, + { + "label": "Chromosome level Hap2", + "output_name": "chr_level_fasta", + "uuid": "495d22c7-d5e4-4fff-a9ba-94b3b77e48de" + } + ] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "errors": null, + "id": 11, + "input_connections": { + "query": { + "id": 10, + "output_name": "chr_level_fasta" + }, + "reflist": { + "id": 9, + "output_name": "chr_level_fasta" + } + }, + "inputs": [], + "label": null, + "name": "mashmap", + "outputs": [ + { + "name": "mashout", + "type": "paf" + } + ], + "position": { + "left": 2093.238037404796, + "top": 543.09319994876 + }, + "post_job_actions": { + "ChangeDatatypeActionmashout": { + "action_arguments": { + "newtype": "tabular" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "mashout" + }, + "RenameDatasetActionmashout": { + "action_arguments": { + "newname": "Mashmap Chromosome level" + }, + "action_type": "RenameDatasetAction", + "output_name": "mashout" + }, + "TagDatasetActionmashout": { + "action_arguments": { + "tags": "mashmap_chrom_level" + }, + "action_type": "TagDatasetAction", + "output_name": "mashout" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a3a6b0b31f2d", + "name": "mashmap", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"dense\": false, \"filter_mode\": \"one-to-one\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"90.0\", \"query\": {\"__class__\": \"ConnectedValue\"}, \"reflist\": {\"__class__\": \"ConnectedValue\"}, \"reportPercentage\": false, \"seqLength\": \"50000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.3+galaxy0", + "type": "tool", + "uuid": "4654b18e-1c4f-49be-b5ed-f6f8c2449311", + "when": null, + "workflow_outputs": [ + { + "label": "Mashmap Chromosome level", + "output_name": "mashout", + "uuid": "41d769a4-4731-44e5-8af9-c983a6e87e07" + } + ] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/vgp_sak_generation/vgp_sak_generation/1.1+galaxy0", + "errors": null, + "id": 12, + "input_connections": { + "agp": { + "id": 2, + "output_name": "corrected_agp" + }, + "hap1_mapping": { + "id": 9, + "output_name": "inter_chr" + }, + "hap2_mapping": { + "id": 10, + "output_name": "inter_chr" + }, + "mashmap": { + "id": 11, + "output_name": "mashout" + } + }, + "inputs": [], + "label": null, + "name": "VGP SAK Generation", + "outputs": [ + { + "name": "sak_file", + "type": "tabular" + }, + { + "name": "orientation", + "type": "tabular" + }, + { + "name": "missing", + "type": "tabular" + } + ], + "position": { + "left": 2531.154465213958, + "top": 455.12055338365 + }, + "post_job_actions": { + "RemoveTagDatasetActionsak_file": { + "action_arguments": { + "tags": "name:hap1" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "sak_file" + }, + "RenameDatasetActionmissing": { + "action_arguments": { + "newname": "Sequences missing in mashmap" + }, + "action_type": "RenameDatasetAction", + "output_name": "missing" + }, + "RenameDatasetActionorientation": { + "action_arguments": { + "newname": "Hap1 Hap2 orientation mapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "orientation" + }, + "RenameDatasetActionsak_file": { + "action_arguments": { + "newname": "Reorientation and renaming instructions" + }, + "action_type": "RenameDatasetAction", + "output_name": "sak_file" + }, + "TagDatasetActionmissing": { + "action_arguments": { + "tags": "Missing_seq_hap2" + }, + "action_type": "TagDatasetAction", + "output_name": "missing" + }, + "TagDatasetActionorientation": { + "action_arguments": { + "tags": "orientation_mapping" + }, + "action_type": "TagDatasetAction", + "output_name": "orientation" + }, + "TagDatasetActionsak_file": { + "action_arguments": { + "tags": "reor_renam_sak" + }, + "action_type": "TagDatasetAction", + "output_name": "sak_file" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/vgp_sak_generation/vgp_sak_generation/1.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8fbdd799f24c", + "name": "vgp_sak_generation", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"agp\": {\"__class__\": \"ConnectedValue\"}, \"hap1_mapping\": {\"__class__\": \"ConnectedValue\"}, \"hap2_mapping\": {\"__class__\": \"ConnectedValue\"}, \"mashmap\": {\"__class__\": \"ConnectedValue\"}, \"query\": \"Hap_2\", \"reference\": \"Hap_1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1+galaxy0", + "type": "tool", + "uuid": "d75312ad-7e80-4f10-b774-ff60f170072d", + "when": null, + "workflow_outputs": [ + { + "label": "Hap1 Hap2 orientation mapping", + "output_name": "orientation", + "uuid": "6c96cb46-30be-47ae-8bed-856e769932a2" + }, + { + "label": "Reorientation and renaming instructions", + "output_name": "sak_file", + "uuid": "1fcd7234-75a2-42a9-a8b6-85cb652c252b" + }, + { + "label": "Sequences missing in mashmap", + "output_name": "missing", + "uuid": "cf779424-01a4-4a14-865a-bbb74b1b2e0b" + } + ] + }, + "13": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 13, + "input_connections": { + "input1": { + "id": 12, + "output_name": "sak_file" + } + }, + "inputs": [], + "label": "Number of lines in sak", + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2965.615048861816, + "top": 159.04593894807329 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "RemoveTagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:hap1" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "1794aeda-1a3d-45b5-85a6-cdcc376a92e7", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 14, + "input_connections": { + "input1": { + "id": 13, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "integer_param", + "type": "expression.json" + } + ], + "position": { + "left": 3231.201364966604, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActioninteger_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "integer_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"integer\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "520eb505-075f-47eb-9976-c7194394bb56", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 15, + "input_connections": { + "input_param_type|input_param": { + "id": 14, + "output_name": "integer_param" + } + }, + "inputs": [], + "label": "If sak empty", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3392.656662631868, + "top": 236.823653154529 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"integer\", \"__current_case__\": 1, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "d5242605-f371-40f8-9507-8becf98aa2a5", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "id": 16, + "input_connections": { + "Fasta Hap2": { + "id": 10, + "input_subworkflow_step_id": 0, + "output_name": "chr_level_fasta" + }, + "Sak File": { + "id": 12, + "input_subworkflow_step_id": 1, + "output_name": "sak_file" + }, + "when": { + "id": 15, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Rename - reorient Hap2", + "outputs": [], + "position": { + "left": 3789.5568247457295, + "top": 687.1248488277643 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Rename - reorient Hap2", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Fasta Hap2" + } + ], + "label": "Fasta Hap2", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 25.52256049984045 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "4641aeb5-c3de-4d18-80b7-058c123be7c5", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Sak File" + } + ], + "label": "Sak File", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 8.94496597072586, + "top": 142.0138313869549 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "60240071-b846-449d-a1a2-4c04ae1565c1", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "errors": null, + "id": 2, + "input_connections": { + "infile": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Text reformatting", + "outputs": [ + { + "name": "outfile", + "type": "input" + } + ], + "position": { + "left": 348.7887131324336, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"code\": \"/^>/ {$1 = $1 \\\"_oldname\\\"} {print}\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"variables\": [], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "ff4d87d3-f0c4-41f3-97b1-1de62cd5160c", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 3, + "input_connections": { + "input_file": { + "id": 2, + "output_name": "outfile" + }, + "mode_condition|swiss_army_knife": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "output", + "type": "fastq" + } + ], + "position": { + "left": 629.2639629769984, + "top": 59.865038123160566 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"manipulation\", \"__current_case__\": 0, \"swiss_army_knife\": {\"__class__\": \"ConnectedValue\"}, \"output_condition\": {\"out_format\": \"fasta\", \"__current_case__\": 0, \"line_length\": null}, \"sort\": \"\", \"remove_terminal_gaps\": false, \"homopolymer_compress\": null, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "a362036e-2623-4fee-84c0-dc03362ce493", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.5+galaxy3", + "errors": null, + "id": 4, + "input_connections": { + "infile": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Text transformation", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 919.057682629259, + "top": 164.7186279741201 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "RemoveTagDatasetActionoutput": { + "action_arguments": { + "tags": "name:hap1" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "output" + }, + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Reoriented Renamed Hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adv_opts\": {\"adv_opts_selector\": \"basic\", \"__current_case__\": 0}, \"code\": \"/^>/ s/_oldname//\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "29f4ad46-2a61-4dea-8d42-de266c7869ed", + "when": null, + "workflow_outputs": [ + { + "label": "Reoriented Renamed Hap2", + "output_name": "output", + "uuid": "fd311297-1df4-4d56-bf3f-47300900b30a" + } + ] + } + }, + "tags": [], + "uuid": "8e47b024-66fd-4814-9039-17c162aaf7c9" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "b39ae7c3-c0d7-4cd4-b0a5-fb8907734064", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 17, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 16, + "output_name": "Reoriented Renamed Hap2" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 10, + "output_name": "chr_level_fasta" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 4211.9929318323675, + "top": 926.4433396647705 + }, + "post_job_actions": { + "RemoveTagDatasetActiondata_param": { + "action_arguments": { + "tags": "name:hap1" + }, + "action_type": "RemoveTagDatasetAction", + "output_name": "data_param" + }, + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Curated Hap2" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "5a3fa2a6-71c1-4836-96c1-d7a0fafd6e06", + "when": null, + "workflow_outputs": [ + { + "label": "Curated Hap2", + "output_name": "data_param", + "uuid": "30ae609a-dfff-45a0-8bd2-00f11df8733d" + } + ] + } + }, + "tags": [], + "uuid": "cdc1ecf6-9b60-41cc-8064-72a5c4c34a3d" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "3069960f-0d08-4f82-a3a3-22c08bcafa8f", + "when": null, + "workflow_outputs": [ + { + "label": "Reorientation and renaming instructions", + "output_name": "Reorientation and renaming instructions", + "uuid": "c4fedc1e-b2fa-4f8a-b74d-680460a8589c" + }, + { + "label": "Curated Hap1", + "output_name": "Curated Hap1", + "uuid": "a798e303-043f-4674-b633-87cb0caa5f27" + }, + { + "label": "Chromosome level Hap2", + "output_name": "Chromosome level Hap2", + "uuid": "768ef302-b9d1-4431-8a7e-06216bc700e9" + }, + { + "label": "Hap2 AGP", + "output_name": "Hap2 AGP", + "uuid": "12f25101-9c98-49d7-9146-2800a698c281" + }, + { + "label": "Hap1 Hap2 orientation mapping", + "output_name": "Hap1 Hap2 orientation mapping", + "uuid": "d03a1314-3fa3-4fd7-999c-10823437d9e9" + }, + { + "label": "Sequences missing in mashmap", + "output_name": "Sequences missing in mashmap", + "uuid": "49387710-583b-4afc-9854-86b6679b7bdf" + }, + { + "label": "Hap2 Unlocs no hap dups AGP", + "output_name": "Hap2 Unlocs no hap dups AGP", + "uuid": "92e05851-e4e6-470e-b5ef-736973081869" + }, + { + "label": "Curated Hap2", + "output_name": "Curated Hap2", + "uuid": "321bccb7-d01f-41f7-9aaa-e0903232b460" + }, + { + "label": "Hap1 Unlocs no hap dups AGP", + "output_name": "Hap1 Unlocs no hap dups AGP", + "uuid": "388137b9-f16f-429d-ab20-e7aa30ec1cfd" + }, + { + "label": "Chromosome mapping Hap2", + "output_name": "Chromosome mapping Hap2", + "uuid": "244730a3-27fe-474d-8b77-34f6f5859ac0" + }, + { + "label": "Hap2 Unlocs", + "output_name": "Hap2 Unlocs", + "uuid": "f010315c-33af-4f0d-af8f-3ff1fd90ac3f" + }, + { + "label": "Hap1 Haplotigs", + "output_name": "Hap1 Haplotigs", + "uuid": "8b63dde3-0bf4-4ee1-8b95-b7d88d5f6d4e" + }, + { + "label": "Mashmap for Hap2 sync", + "output_name": "Mashmap Chromosome level", + "uuid": "bf5f14d9-92a3-40ad-ac10-bf35c9666461" + }, + { + "label": "Hap1 AGP", + "output_name": "Hap1 AGP", + "uuid": "00aab713-ec0d-4151-9a6a-bcf73372caa1" + }, + { + "label": "Corrected AGP", + "output_name": "Corrected AGP", + "uuid": "684e5920-a989-4e78-8efe-a22486afdc2e" + }, + { + "label": "Hap1 Unlocs", + "output_name": "Hap1 Unlocs", + "uuid": "207271be-1854-4018-b329-30fbcc8d93e1" + }, + { + "label": "Chromosome mapping Hap1", + "output_name": "Chromosome mapping Hap1", + "uuid": "10ffbfb0-3350-4dd0-b3f0-35e5ccbe9efb" + } + ] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "errors": null, + "id": 21, + "input_connections": { + "library|input_1": { + "id": 6, + "output_name": "output" + }, + "when": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": "Trim Hi-C reads 2", + "name": "Cutadapt", + "outputs": [ + { + "name": "out_pairs", + "type": "input" + }, + { + "name": "report", + "type": "txt" + } + ], + "position": { + "left": 576.3014797564446, + "top": 513.2633935186325 + }, + "post_job_actions": { + "HideDatasetActionout_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_pairs" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + }, + "RenameDatasetActionout1": { + "action_arguments": { + "newname": "Trimmed Hi-C Forward Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out1" + }, + "RenameDatasetActionout2": { + "action_arguments": { + "newname": "Trimmed Hi-C Reverse Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out2" + }, + "RenameDatasetActionout_pairs": { + "action_arguments": { + "newname": "Trimmed Hi-C data" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_pairs" + }, + "RenameDatasetActionreport": { + "action_arguments": { + "newname": "Report Hi-C reads trimming" + }, + "action_type": "RenameDatasetAction", + "output_name": "report" + }, + "TagDatasetActionreport": { + "action_arguments": { + "tags": "trimmed_hic" + }, + "action_type": "TagDatasetAction", + "output_name": "report" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f6168dd17f82", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"paired_collection\", \"__current_case__\": 2, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": []}, \"r2\": {\"adapters2\": [], \"front_adapters2\": [], \"anywhere_adapters2\": []}, \"pair_adapters\": false}, \"other_trimming_options\": {\"cut\": \"5\", \"cut2\": \"5\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": [\"report\"], \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "5.2+galaxy2", + "type": "tool", + "uuid": "da049fb3-1faf-469d-a1c6-532a705b5f81", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "errors": null, + "id": 22, + "input_connections": { + "library|input_1": { + "id": 9, + "output_name": "output" + }, + "when": { + "id": 10, + "output_name": "output" + } + }, + "inputs": [], + "label": "Remove adapters from Hifi reads", + "name": "Cutadapt", + "outputs": [ + { + "name": "out1", + "type": "fastqsanger" + } + ], + "position": { + "left": 437.97142521506464, + "top": 916.1608721637111 + }, + "post_job_actions": { + "HideDatasetActionout1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/5.2+galaxy2", + "tool_shed_repository": { + "changeset_revision": "f6168dd17f82", + "name": "cutadapt", + "owner": "lparsons", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapter_options\": {\"action\": \"trim\", \"error_rate\": \"0.1\", \"no_indels\": false, \"times\": \"1\", \"overlap\": \"3\", \"match_read_wildcards\": false, \"no_match_adapter_wildcards\": true, \"revcomp\": false}, \"filter_options\": {\"discard_trimmed\": false, \"discard_untrimmed\": false, \"minimum_length\": \"1\", \"minimum_length2\": null, \"maximum_length\": null, \"maximum_length2\": null, \"max_n\": null, \"max_expected_errors\": null, \"max_average_error_rate\": null, \"discard_casava\": false, \"pair_filter\": \"any\"}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"r1\": {\"adapters\": [], \"front_adapters\": [], \"anywhere_adapters\": [{\"__index__\": 0, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT\"}, \"single_noindels\": false}, {\"__index__\": 1, \"adapter_source\": {\"adapter_source_list\": \"user\", \"__current_case__\": 0, \"adapter_name\": \"\", \"adapter\": \"ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT\"}, \"single_noindels\": false}]}}, \"other_trimming_options\": {\"cut\": \"0\", \"cut2\": \"0\", \"quality_cutoff\": \"0\", \"quality_cutoff2\": \"\", \"nextseq_trim\": \"0\", \"trim_n\": false, \"poly_a\": false, \"shorten_options\": {\"shorten_values\": \"False\", \"__current_case__\": 1}, \"shorten_options_r2\": {\"shorten_values_r2\": \"False\", \"__current_case__\": 1}}, \"output_selector\": null, \"read_mod_options\": {\"strip_suffix\": null, \"length_tag\": null, \"rename\": null, \"zero_cap\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "5.2+galaxy2", + "type": "tool", + "uuid": "31e44d21-dae5-4274-8ce4-7f9c4d0297fc", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "errors": null, + "id": 23, + "input_connections": { + "query": { + "id": 20, + "output_name": "Curated Hap1" + }, + "reflist": { + "id": 20, + "output_name": "Curated Hap2" + } + }, + "inputs": [], + "label": null, + "name": "mashmap", + "outputs": [ + { + "name": "mashout", + "type": "paf" + } + ], + "position": { + "left": 1166.414795365427, + "top": 1858.0684823932263 + }, + "post_job_actions": { + "RenameDatasetActionmashout": { + "action_arguments": { + "newname": "Mashmap Chromosome level" + }, + "action_type": "RenameDatasetAction", + "output_name": "mashout" + }, + "TagDatasetActionmashout": { + "action_arguments": { + "tags": "mashout_chrom_level" + }, + "action_type": "TagDatasetAction", + "output_name": "mashout" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mashmap/mashmap/3.1.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a3a6b0b31f2d", + "name": "mashmap", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"dense\": false, \"filter_mode\": \"map\", \"kmerComplexity\": null, \"kmerThreshold\": null, \"noHgFilter\": false, \"noMerge\": false, \"perc_identity\": \"90.0\", \"query\": {\"__class__\": \"ConnectedValue\"}, \"reflist\": {\"__class__\": \"ConnectedValue\"}, \"reportPercentage\": false, \"seqLength\": \"5000\", \"sketchSize\": \"0\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.3+galaxy0", + "type": "tool", + "uuid": "123b9290-30e5-4f56-8d21-ec54b9efd4c5", + "when": null, + "workflow_outputs": [ + { + "label": "Mashmap Chromosome level", + "output_name": "mashout", + "uuid": "dcc5077c-c67d-4385-9599-8f0d1acfdfae" + } + ] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 24, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 21, + "output_name": "out_pairs" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 958.7497062539729, + "top": 493.2911785198683 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "b5d1b3d6-3a2c-4cea-90b6-ea01d09cb559", + "when": null, + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 25, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 22, + "output_name": "out1" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 9, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 834.1418058245903, + "top": 734.9155747225174 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "6a32dbce-9998-4f2f-adfc-3f38b14d7211", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "id": 26, + "input_connections": { + "Bin Size for BigWig files": { + "id": 14, + "input_subworkflow_step_id": 10, + "output_name": "output" + }, + "Canonical telomeric pattern": { + "id": 11, + "input_subworkflow_step_id": 8, + "output_name": "output" + }, + "Database for Compleasm Genes": { + "id": 5, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Generate Gene Tracks with Compleasm?": { + "id": 3, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Generate high resolution Hi-C maps?": { + "id": 15, + "input_subworkflow_step_id": 11, + "output_name": "output" + }, + "Haplotype": { + "id": 16, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Haplotype fasta": { + "id": 20, + "input_subworkflow_step_id": 1, + "output_name": "Curated Hap1" + }, + "Hi-C reads": { + "id": 24, + "input_subworkflow_step_id": 4, + "output_name": "data_param" + }, + "Minimum Mapping Quality": { + "id": 13, + "input_subworkflow_step_id": 5, + "output_name": "output" + }, + "PacBio reads": { + "id": 25, + "input_subworkflow_step_id": 7, + "output_name": "data_param" + }, + "Remove duplicated Hi-C reads?": { + "id": 8, + "input_subworkflow_step_id": 6, + "output_name": "output" + }, + "Telomere patterns to explore (comma-separated), IUPAC allowed": { + "id": 12, + "input_subworkflow_step_id": 9, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "", + "name": "Hic Map Hap1" + } + ], + "label": "Hic Map Hap1", + "name": "Post Curation 1 haplotype", + "outputs": [], + "position": { + "left": 1689.5390625, + "top": 20.3359375 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [ + { + "child_steps": [ + 21, + 22, + 29, + 34, + 40, + 41, + 48, + 51, + 54, + 57, + 59, + 61, + 63, + 65 + ], + "color": "orange", + "data": { + "title": "Add tracks to the Hi-C map - MAPQ filtering" + }, + "id": 6, + "position": [ + 4478.6, + 996 + ], + "size": [ + 3239, + 908 + ], + "type": "frame" + }, + { + "child_steps": [ + 12, + 18 + ], + "color": "red", + "data": { + "title": "Gaps" + }, + "id": 2, + "position": [ + 2202.6, + 764.8 + ], + "size": [ + 542, + 213 + ], + "type": "frame" + }, + { + "child_steps": [ + 16, + 23, + 24, + 30, + 35, + 36, + 43, + 46, + 49, + 52, + 55 + ], + "color": "green", + "data": { + "title": "Coverage" + }, + "id": 4, + "position": [ + 2215.442990374414, + 2411.7000000000003 + ], + "size": [ + 2060, + 530 + ], + "type": "frame" + }, + { + "child_steps": [ + 17, + 38, + 25, + 26, + 31, + 32, + 37, + 44, + 45 + ], + "color": "lime", + "data": { + "title": "Telomeres" + }, + "id": 3, + "position": [ + 2425.542990374414, + 1275.4 + ], + "size": [ + 1479, + 607 + ], + "type": "frame" + }, + { + "child_steps": [ + 14 + ], + "color": "yellow", + "data": { + "title": "Trim and align Hi-C reads" + }, + "id": 0, + "position": [ + 1320.042990374414, + 1132.8000000000002 + ], + "size": [ + 910, + 990 + ], + "type": "frame" + }, + { + "child_steps": [ + 13, + 27 + ], + "color": "turquoise", + "data": { + "title": "Egapx Annotations" + }, + "id": 1, + "position": [ + 1870.642990374414, + 0 + ], + "size": [ + 1514, + 679 + ], + "type": "frame" + }, + { + "child_steps": [ + 19, + 20, + 28, + 33, + 39, + 42, + 47, + 50, + 53, + 56, + 58, + 62, + 64, + 60 + ], + "color": "none", + "data": { + "title": "Generate Pretext Maps and Tracks - Multimapping" + }, + "id": 5, + "position": [ + 4494.9, + 115.7 + ], + "size": [ + 3564, + 773 + ], + "type": "frame" + } + ], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Post Curation 1 haplotype", + "report": { + "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nMarkduplicate deduplication stats (if applicable)\n\n```galaxy\nhistory_dataset_embedded(output=\"Markduplicates Summary\")\n```\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot - Multimapping\")\n```\n\n\nWith MAPQ filtering\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot\")\n```\n\n\n\n\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Database for Compleasm Genes" + } + ], + "label": "Database for Compleasm Genes", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 0, + "top": 182.19274222599256 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "c5aa113e-5a56-4b29-8d56-6c1eb8a3fd25", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Haplotype fasta" + } + ], + "label": "Haplotype fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 52.49787906257684, + "top": 280.38975521515187 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "00b7518c-0935-4e68-a6e4-82179a35404a", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Haplotype" + } + ], + "label": "Haplotype", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 104.44344666958791, + "top": 446.2752821316836 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "f84e044d-8247-4c4d-a554-3a684fba2914", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Generate Gene Tracks with Compleasm?" + } + ], + "label": "Generate Gene Tracks with Compleasm?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 197.32514678734688, + "top": 603.2273611572942 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "5415eba3-fd92-40fc-a888-e9d7ee08ecd2", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "Collection containing the Hi-C reads. ", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "Collection containing the Hi-C reads. ", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 252.41826753913148, + "top": 870.7233163408231 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "42ec35b8-88d2-4390-a134-8fbd25142973", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 20 ", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 20 ", + "name": "Minimum Mapping Quality" + } + ], + "label": "Minimum Mapping Quality", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 355.85421204811183, + "top": 1093.2951880767228 + }, + "tool_id": null, + "tool_state": "{\"default\": 10, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "cd8cc71f-d3b4-4251-8078-e6fad5337261", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Remove duplicated Hi-C reads?" + } + ], + "label": "Remove duplicated Hi-C reads?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 410.0429063272865, + "top": 1218.4113822445638 + }, + "tool_id": null, + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "a38c23e6-55ec-4178-a127-e907d4395c25", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "PacBio reads" + } + ], + "label": "PacBio reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 469.16532647310174, + "top": 1391.176617378092 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "8bc4fc4e-1a1a-43e8-b4bc-5115fefb541d", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "The default value is set for vertebrate genomes (CCCTAA).", + "content_id": null, + "errors": null, + "id": 8, + "input_connections": {}, + "inputs": [ + { + "description": "The default value is set for vertebrate genomes (CCCTAA).", + "name": "Canonical telomeric pattern" + } + ], + "label": "Canonical telomeric pattern", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 543.9849789808709, + "top": 1511.1007389804276 + }, + "tool_id": null, + "tool_state": "{\"default\": \"TTAGGG\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "84c91e14-1709-4602-8771-eea1dadf471b", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 9, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomere patterns to explore (comma-separated), IUPAC allowed" + } + ], + "label": "Telomere patterns to explore (comma-separated), IUPAC allowed", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 668.2666309067496, + "top": 1679.641738264636 + }, + "tool_id": null, + "tool_state": "{\"default\": \"TTAGGG,CCCTAA\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "aedd2336-53ba-4d1d-9e82-56bc7fa929bf", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 10, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Bin Size for BigWig files" + } + ], + "label": "Bin Size for BigWig files", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 787.089494227972, + "top": 1849.203070097743 + }, + "tool_id": null, + "tool_state": "{\"default\": 100, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "52873498-7180-4050-82a3-58837bff2d87", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 11, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Generate high resolution Hi-C maps?" + } + ], + "label": "Generate high resolution Hi-C maps?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 890.5293322248995, + "top": 1994.7404317039259 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "0f0df32f-53bf-4a2d-8931-191f8ec5b4c4", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 12, + "input_connections": { + "input_file": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2242.2245339478322, + "top": 819.2167640182922 + }, + "post_job_actions": { + "ChangeDatatypeActionstats": { + "action_arguments": { + "newtype": "bed" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "stats" + }, + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "${Haplotype} Gaps BED" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "Gaps_bed" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"coordinates\", \"__current_case__\": 1, \"out_coord\": \"g\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "7ef0994f-1ebf-4d9d-8799-cd6f42cb0c0c", + "when": null, + "workflow_outputs": [ + { + "label": "Gaps BED", + "output_name": "stats", + "uuid": "4a7f2ef2-c635-4ddb-b23b-8546f9290ef9" + } + ] + }, + "13": { + "annotation": "", + "id": 13, + "input_connections": { + "Database for Compleasm Genes": { + "id": 0, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Haplotype fasta": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "when": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Generate Compleasm Gene Track", + "outputs": [], + "position": { + "left": 2274.7101468393334, + "top": 224.51855946581205 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [ + { + "child_steps": [ + 2, + 3, + 4, + 5 + ], + "color": "turquoise", + "data": { + "title": "Egapx Annotations" + }, + "id": 0, + "position": [ + 241.15428294247886, + 0 + ], + "size": [ + 1514, + 679 + ], + "type": "frame" + } + ], + "format-version": "0.1", + "name": "Generate Compleasm Gene Track", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Haplotype fasta" + } + ], + "label": "Haplotype fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 266.4630172025337 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "68575318-3e76-4941-98f0-02eea53845cb", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Database for Compleasm Genes" + } + ], + "label": "Database for Compleasm Genes", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 2.984821764465323, + "top": 386.30643645389887 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "23900e15-92df-4f0f-b8f2-74872cc57dc1", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "errors": null, + "id": 2, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + }, + "lineage_dataset": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "compleasm", + "outputs": [ + { + "name": "full_table_busco", + "type": "tsv" + }, + { + "name": "miniprot", + "type": "gff3" + }, + { + "name": "summary", + "type": "txt" + } + ], + "position": { + "left": 560.0669948496356, + "top": 228.2562538342695 + }, + "post_job_actions": { + "HideDatasetActionfull_table_busco": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "full_table_busco" + }, + "HideDatasetActionminiprot": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "miniprot" + }, + "RenameDatasetActionsummary": { + "action_arguments": { + "newname": "${Haplotype} Compleasm Summary" + }, + "action_type": "RenameDatasetAction", + "output_name": "summary" + }, + "TagDatasetActionsummary": { + "action_arguments": { + "tags": "compleasm_summary" + }, + "action_type": "TagDatasetAction", + "output_name": "summary" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "tool_shed_repository": { + "changeset_revision": "fc7334661489", + "name": "compleasm", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"busco_database\": \"v5\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\", \"summary\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.6+galaxy3", + "type": "tool", + "uuid": "5d392bdf-4fd3-433d-a38d-cb680f742cfb", + "when": null, + "workflow_outputs": [ + { + "label": "Compleasm Summary", + "output_name": "summary", + "uuid": "7607b4eb-0ae4-46c8-8456-d226a22f5ad4" + }, + { + "label": "miniprot", + "output_name": "miniprot", + "uuid": "2310c55a-eb57-4779-9183-a5bfaee21947" + } + ] + }, + "3": { + "annotation": "", + "content_id": "gff2bed1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "miniprot" + } + }, + "inputs": [], + "label": null, + "name": "GFF-to-BED", + "outputs": [ + { + "name": "out_file1", + "type": "bed" + } + ], + "position": { + "left": 888.1010300332687, + "top": 454.0897176874731 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "gff2bed1", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.1", + "type": "tool", + "uuid": "5d5edff4-0c51-4cd2-9433-43b752f1460c", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1177.3320452520443, + "top": 239.10806772114108 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "1e143b84-a21d-4401-9025-c3c79912f371", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "errors": null, + "id": 5, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1342.90747480956, + "top": 447.3406434911534 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Genes track" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "gene_track" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "tool_shed_repository": { + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": \"200\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.1", + "type": "tool", + "uuid": "f1878a29-df66-4aa6-96ab-28e5b6d8bff6", + "when": null, + "workflow_outputs": [ + { + "label": "Genes track", + "output_name": "out_file1", + "uuid": "b3dda081-662f-44d9-8ada-92f53536e892" + } + ] + } + }, + "tags": [], + "uuid": "f0ee0749-4613-47ca-88a0-11e7228a6557" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "0514d7a4-a26d-4e74-8a9b-3a0341d52312", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "Compleasm Summary", + "output_name": "Compleasm Summary", + "uuid": "46239fdd-42cd-41c4-9097-eee0b35d5371" + }, + { + "label": "Genes track", + "output_name": "Genes track", + "uuid": "8b1f9cee-cb6d-439e-bcf7-fdcc771723a8" + }, + { + "label": "miniprot", + "output_name": "miniprot", + "uuid": "c9366441-f60d-424f-903e-42c05fcb90c5" + } + ] + }, + "14": { + "annotation": "", + "id": 14, + "input_connections": { + "Hi-C reads": { + "id": 4, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Reference": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Remove HiC duplicates ?": { + "id": 6, + "input_subworkflow_step_id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Trim, Align, deduplicate Hi-C - Post-curation", + "outputs": [], + "position": { + "left": 1592.404466193863, + "top": 1296.6364383923997 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Trim, Align, deduplicate Hi-C - Post-curation", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 1.", + "name": "Reference" + } + ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 19.61889440014272, + "top": 296.72393325180246 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 676.2512666175143 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Remove HiC duplicates ?" + } + ], + "label": "Remove HiC duplicates ?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 36.63867101835399, + "top": 821.9062390635704 + }, + "tool_id": null, + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "0bae4fec-19e6-4ee8-a9ad-275f8645feec", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "errors": null, + "id": 3, + "input_connections": { + "reference": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2 indexer", + "outputs": [ + { + "name": "index", + "type": "bwa_mem2_index" + } + ], + "position": { + "left": 449.5276061235436, + "top": 356.5526534419638 + }, + "post_job_actions": { + "HideDatasetActionindex": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "index" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "5def9e34-fa09-4977-aa55-aa7fc4f4d46e", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3", + "errors": null, + "id": 4, + "input_connections": { + "infile": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Search in textfiles", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 1398.2033872739419, + "top": 3.9427453625997657 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-G\", \"url_paste\": \">\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "b06586f9-7bb2-469d-87c5-a79ac25c2040", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "id": 5, + "input_connections": { + "0:Input dataset collection": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", + "outputs": [], + "position": { + "left": 761.1706984123516, + "top": 865.2761180121176 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "45a60cd2-4176-46d6-9e72-62c4597f00ca", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "False when removal is true", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 2312.6587965954513, + "top": 1420.0180180585944 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0e46e40d-7c7b-4f47-a269-a12807e0b87a", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "errors": null, + "id": 7, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 3, + "output_name": "index" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 785.005162414401, + "top": 500.770155449531 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + }, + "RenameDatasetActionbam_output": { + "action_arguments": { + "newname": "Hi-C Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "errors": null, + "id": 8, + "input_connections": { + "bamfile": { + "id": 7, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools fixmate", + "outputs": [ + { + "name": "output", + "type": "qname_sorted.bam" + } + ], + "position": { + "left": 1244.3562505927885, + "top": 490.91412456456 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "qname_sorted.bam" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "84819580b8a5", + "name": "samtools_fixmate", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addms\": true, \"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"noprop\": false, \"remsec\": false, \"tempcigar\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "1db82bd3-3108-4f39-a0f0-f9e5450e1f4f", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "errors": null, + "id": 9, + "input_connections": { + "input1": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools sort", + "outputs": [ + { + "name": "output1", + "type": "bam" + } + ], + "position": { + "left": 1637.3166686019842, + "top": 519.3556477175839 + }, + "post_job_actions": { + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "tool_shed_repository": { + "changeset_revision": "69dca890852c", + "name": "samtools_sort", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"minhash\": false, \"prim_key_cond\": {\"prim_key_select\": \"\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "5033d744-4b6d-4486-b2ea-732697d51e45", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", + "errors": null, + "id": 10, + "input_connections": { + "chroms_path": { + "id": 4, + "output_name": "output" + }, + "sam_path": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pairtools parse", + "outputs": [ + { + "name": "output_parsed_pairs", + "type": "4dn_pairsam" + }, + { + "name": "parsed_pairs_stats", + "type": "tabular" + } + ], + "position": { + "left": 2275.3946896270036, + "top": 66.3908541727944 + }, + "post_job_actions": { + "HideDatasetActionoutput_parsed_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_parsed_pairs" + }, + "HideDatasetActionparsed_pairs_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "parsed_pairs_stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "a5876cca7b05", + "name": "pairtools_parse", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"assembly_name\": \"\", \"chroms_path\": {\"__class__\": \"ConnectedValue\"}, \"compress_output\": true, \"drop_readid\": false, \"drop_sam\": true, \"drop_seq\": true, \"max_inter_algn_gap\": \"20\", \"max_molecule_size\": \"2000\", \"min_mapq\": \"1\", \"output_stats\": true, \"sam_path\": {\"__class__\": \"ConnectedValue\"}, \"select_add_columns\": {\"add_columns_selection\": \"no\", \"__current_case__\": 1}, \"sort_output\": true, \"walks_policy\": \"mask\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.3+galaxy6", + "type": "tool", + "uuid": "9205b952-9164-4ba4-9c25-4456a206e12b", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 11, + "input_connections": { + "input": { + "id": 9, + "output_name": "output1" + }, + "when": { + "id": 5, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 1980.8010618435853, + "top": 483.13780589990847 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "22bcd1ca-c4f9-4802-b545-c20f2f7798f4", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "errors": null, + "id": 12, + "input_connections": { + "bamfiles": { + "id": 9, + "output_name": "output1" + }, + "when": { + "id": 5, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 2001.1280622744214, + "top": 775.3922577847298 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "c8bc9d08b0e3", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "03cf4998-54d1-43b4-9005-828e8e1da14c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "errors": null, + "id": 13, + "input_connections": { + "pairs_path": { + "id": 10, + "output_name": "output_parsed_pairs" + } + }, + "inputs": [], + "label": null, + "name": "Pairtools dedup", + "outputs": [ + { + "name": "output_dedup_pairs", + "type": "input" + }, + { + "name": "dedup_pairs_stats", + "type": "tabular" + } + ], + "position": { + "left": 2617.665517793338, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActiondedup_pairs_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "dedup_pairs_stats" + }, + "HideDatasetActionoutput_dedup_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_dedup_pairs" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "3d1d241ceff2", + "name": "pairtools_dedup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"compress_output\": true, \"mark_dups\": true, \"max_mismatch\": \"0\", \"output_bytile_stats\": false, \"output_dups\": false, \"output_stats\": true, \"pairs_path\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.3+galaxy6", + "type": "tool", + "uuid": "222ad224-925a-495f-ab74-44c2fb2af4a4", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 14, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 12, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 11, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2378.5723525329613, + "top": 771.7493692529479 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Merged Hi-C Alignments on Curated Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_alignments_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e9571afc-84e8-44b7-a213-8d484124a0bc", + "when": null, + "workflow_outputs": [ + { + "label": "Merged Hi-C Alignments on Curated Assembly", + "output_name": "data_param", + "uuid": "2604d937-9ced-4733-9262-d8ea56c34f1c" + } + ] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", + "errors": null, + "id": 15, + "input_connections": { + "input_tabular": { + "id": 13, + "output_name": "dedup_pairs_stats" + } + }, + "inputs": [], + "label": null, + "name": "Column join", + "outputs": [ + { + "name": "tabular_output", + "type": "tabular" + } + ], + "position": { + "left": 2991.2596185435405, + "top": 513.4889769208286 + }, + "post_job_actions": { + "RenameDatasetActiontabular_output": { + "action_arguments": { + "newname": "Hi-C duplication stats on Curated Assembly: Raw" + }, + "action_type": "RenameDatasetAction", + "output_name": "tabular_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", + "tool_shed_repository": { + "changeset_revision": "3ddd99c7efee", + "name": "collection_column_join", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fill_char\": \".\", \"has_header\": \"0\", \"identifier_column\": \"1\", \"include_outputs\": null, \"input_tabular\": {\"__class__\": \"ConnectedValue\"}, \"old_col_in_header\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.3", + "type": "tool", + "uuid": "9b13d478-eb6a-410d-9fb0-aa13a4543d0e", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C duplication stats on Curated Assembly: Raw", + "output_name": "tabular_output", + "uuid": "9f860ab0-175e-4cf6-a457-4e47dc88d73c" + } + ] + }, + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0", + "errors": null, + "id": 16, + "input_connections": { + "results_0|software_cond|input": { + "id": 13, + "output_name": "dedup_pairs_stats" + } + }, + "inputs": [], + "label": "Pairtools MultiQC", + "name": "MultiQC", + "outputs": [ + { + "name": "plots", + "type": "input" + }, + { + "name": "png_plot", + "type": "input" + }, + { + "name": "html_report", + "type": "html" + }, + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 3337.1669910312694, + "top": 301.5986199229453 + }, + "post_job_actions": { + "ChangeDatatypeActionstats": { + "action_arguments": { + "newtype": "tsv" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "stats" + }, + "HideDatasetActionplots": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "plots" + }, + "RenameDatasetActionhtml_report": { + "action_arguments": { + "newname": "Hi-C duplication stats on Curated Assembly: MultiQC" + }, + "action_type": "RenameDatasetAction", + "output_name": "html_report" + }, + "RenameDatasetActionpng_plot": { + "action_arguments": { + "newname": "Pairtools MultiQC on Curated Assembly: Plots" + }, + "action_type": "RenameDatasetAction", + "output_name": "png_plot" + }, + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Pairtools MultiQC Stats on Curated Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionhtml_report": { + "action_arguments": { + "tags": "hic_dup_multiqc_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "html_report" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "hic_dup_raw_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0", + "tool_shed_repository": { + "changeset_revision": "26ee5e11ecbe", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": true, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"pairtools\", \"__current_case__\": 39, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"Hi-C alignements to Scaffold stats\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.33+galaxy0", + "type": "tool", + "uuid": "66905684-e6a1-4d2a-91ad-4809ca5e864a", + "when": null, + "workflow_outputs": [ + { + "label": "Pairtools MultiQC on Curated Assembly: Plots", + "output_name": "png_plot", + "uuid": "b1b67ffc-1027-4ab4-8ccb-6648250469d8" + }, + { + "label": "Hi-C duplication stats on Curated Assembly: MultiQC", + "output_name": "html_report", + "uuid": "bc63d054-d54c-4edc-9486-54328686a2dd" + }, + { + "label": "Pairtools MultiQC Stats on Curated Assembly", + "output_name": "stats", + "uuid": "9d38be8e-bf66-4918-aa21-e9ec59321964" + } + ] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "errors": null, + "id": 17, + "input_connections": { + "bamfile": { + "id": 14, + "output_name": "data_param" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "Remove duplicates", + "name": "Samtools markdup", + "outputs": [ + { + "name": "output", + "type": "bam" + }, + { + "name": "stats_output", + "type": "txt" + } + ], + "position": { + "left": 2861.3187898750775, + "top": 904.7579298870468 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionstats_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "stats_output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "name:no_duplicates" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "ef678e1f70a2", + "name": "samtools_markdup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": false, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "294a749f-e96a-45d7-9e2b-fd71d0afe5b2", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "errors": null, + "id": 18, + "input_connections": { + "bamfile": { + "id": 14, + "output_name": "data_param" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Keep duplicated", + "name": "Samtools markdup", + "outputs": [ + { + "name": "output", + "type": "bam" + }, + { + "name": "stats_output", + "type": "txt" + } + ], + "position": { + "left": 2852.9687490971037, + "top": 1184.7675817632073 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionstats_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "stats_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "ef678e1f70a2", + "name": "samtools_markdup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "9172e934-6ce0-4bc6-a526-e3d3fe539e58", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 19, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 17, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 18, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3242.918659711446, + "top": 959.7107727965537 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Hi-C alignments on Curated Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "curated_hic_alignments" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0dc73407-3c85-4837-9efc-7046cbe9625e", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C alignments on Curated Assembly", + "output_name": "data_param", + "uuid": "e3031d04-dad3-4de0-a6f5-32303ed180fb" + } + ] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 20, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 17, + "output_name": "stats_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 18, + "output_name": "stats_output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3242.04780593084, + "top": 1189.1824762726665 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Hi-C duplication stats on on Curated Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "hi_dup_stats_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e1be9200-6f90-4b6f-a920-416e730a4721", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C duplication stats on Curated Assembly", + "output_name": "data_param", + "uuid": "0173122b-d613-446c-88b5-b63b053d2e93" + } + ] + } + }, + "tags": [], + "uuid": "6f194a56-a67f-4b0e-b19f-538c9eb518d4" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "1e3fc9c0-027f-4225-a44d-ff4bc49e09be", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C alignments on Curated Assembly", + "output_name": "Hi-C alignments on Curated Assembly", + "uuid": "11c59f61-6a90-4a86-b177-ebeca7625058" + }, + { + "label": "Pairtools MultiQC Stats on Curated Assembly", + "output_name": "Pairtools MultiQC Stats on Curated Assembly", + "uuid": "5d25f9c5-29d5-4c09-8f8c-d8d5e8490c8e" + }, + { + "label": "Hi-C duplication stats on Curated Assembly: MultiQC", + "output_name": "Hi-C duplication stats on Curated Assembly: MultiQC", + "uuid": "f368f172-2ce4-48f8-90f8-598f36f9d929" + }, + { + "label": "Pairtools MultiQC on Curated Assembly: Plots", + "output_name": "Pairtools MultiQC on Curated Assembly: Plots", + "uuid": "82f7e452-e9aa-4a2b-8a57-b8efe25ae400" + }, + { + "label": "Merged Hi-C Alignments on Curated Assembly", + "output_name": "Merged Hi-C Alignments on Curated Assembly", + "uuid": "debd9187-ec5a-40c0-b6f3-df3eedb3e6ba" + }, + { + "label": "Hi-C duplication stats on Curated Assembly", + "output_name": "Hi-C duplication stats on Curated Assembly", + "uuid": "f68d314f-483d-4ab9-92c2-140209d756b1" + }, + { + "label": "Hi-C duplication stats on Curated Assembly: Raw", + "output_name": "Hi-C duplication stats on Curated Assembly: Raw", + "uuid": "6730fdf8-e9c7-4d87-9e67-aa7213f94168" + } + ] + }, + "15": { + "annotation": "", + "id": 15, + "input_connections": { + "0:Input dataset collection": { + "id": 7, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", + "outputs": [], + "position": { + "left": 1821.0694803285596, + "top": 2240.200932961109 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "c96d9580-43de-4a1a-a59a-3d46b80511c3", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2", + "errors": null, + "id": 16, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 7, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Map with minimap2", + "outputs": [ + { + "name": "alignment_output", + "type": "bam" + } + ], + "position": { + "left": 2235.680136974393, + "top": 2559.438004636745 + }, + "post_job_actions": { + "HideDatasetActionalignment_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "alignment_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2", + "tool_shed_repository": { + "changeset_revision": "539de907fd99", + "name": "minimap2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": true}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-hifi\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.28+galaxy2", + "type": "tool", + "uuid": "9c9cf464-20c0-457f-9c37-8a7018546bd1", + "when": null, + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "errors": null, + "id": 17, + "input_connections": { + "canonical": { + "id": 8, + "output_name": "output" + }, + "input_sequence": { + "id": 1, + "output_name": "output" + }, + "patterns": { + "id": 9, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Teloscope", + "outputs": [ + { + "name": "terminal_telomeres", + "type": "bed" + }, + { + "name": "telo_report", + "type": "tabular" + } + ], + "position": { + "left": 2461.6835427414335, + "top": 1451.8267720836484 + }, + "post_job_actions": { + "RenameDatasetActiontelo_report": { + "action_arguments": { + "newname": "${Haplotype} Telomere Report" + }, + "action_type": "RenameDatasetAction", + "output_name": "telo_report" + }, + "RenameDatasetActionterminal_telomeres": { + "action_arguments": { + "newname": "${Haplotype} terminal telomeres" + }, + "action_type": "RenameDatasetAction", + "output_name": "terminal_telomeres" + }, + "TagDatasetActiontelo_report": { + "action_arguments": { + "tags": "telomere_report" + }, + "action_type": "TagDatasetAction", + "output_name": "telo_report" + }, + "TagDatasetActionterminal_telomeres": { + "action_arguments": { + "tags": "terminal_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "terminal_telomeres" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "321ceb58023e", + "name": "teloscope", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"canonical\": {\"__class__\": \"ConnectedValue\"}, \"edit_distance\": \"0\", \"input_sequence\": {\"__class__\": \"ConnectedValue\"}, \"max_block_distance\": \"200\", \"max_match_distance\": \"50\", \"min_block_density\": \"0.5\", \"min_block_length\": \"500\", \"out_entropy\": false, \"out_gc\": false, \"out_its\": false, \"out_matches\": false, \"out_win_repeats\": false, \"patterns\": {\"__class__\": \"ConnectedValue\"}, \"step\": \"500\", \"terminal_limit\": \"50000\", \"ultra_fast\": true, \"verbose\": false, \"window\": \"1000\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.3+galaxy1", + "type": "tool", + "uuid": "51ef86cd-c51f-4573-a799-e9bf46af370e", + "when": null, + "workflow_outputs": [ + { + "label": "Telomere Report", + "output_name": "telo_report", + "uuid": "83cf865b-a124-4a84-9cf7-8bb6d966ad7c" + }, + { + "label": "terminal telomeres", + "output_name": "terminal_telomeres", + "uuid": "edf9292a-fd55-4391-80ca-d8e0eef89960" + } + ] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "errors": null, + "id": 18, + "input_connections": { + "input": { + "id": 12, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2470.2346886538007, + "top": 819.9547819589295 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "${Haplotype} Gaps BEDgraph" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "Gaps" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "tool_shed_repository": { + "changeset_revision": "aff5135563c6", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"abs(int(c3)-int(c2))\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.1", + "type": "tool", + "uuid": "659f271c-28fd-4b7d-807a-06c7189b159d", + "when": null, + "workflow_outputs": [ + { + "label": "Gaps BEDgraph", + "output_name": "out_file1", + "uuid": "9fa64361-b645-4ca3-91cd-4a0d13f13a41" + } + ] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "errors": null, + "id": 19, + "input_connections": { + "highRes": { + "id": 11, + "output_name": "output" + }, + "input": { + "id": 14, + "output_name": "Hi-C alignments on Curated Assembly" + } + }, + "inputs": [], + "label": "PretextMap - Multimapping", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4590.5690510539025, + "top": 260.3319062633357 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + }, + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "056f86469460", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.3+galaxy0", + "type": "tool", + "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", + "when": null, + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "input": { + "id": 14, + "output_name": "Hi-C alignments on Curated Assembly" + }, + "when": { + "id": 11, + "output_name": "output" + } + }, + "inputs": [], + "label": "PretextMap - Multimapping for snapshot if high res", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4594.644731598934, + "top": 647.6895092708705 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "056f86469460", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.3+galaxy0", + "type": "tool", + "uuid": "ba2e3acb-c0d9-4cd8-99a5-7f4a8a790336", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "errors": null, + "id": 21, + "input_connections": { + "highRes": { + "id": 11, + "output_name": "output" + }, + "input": { + "id": 14, + "output_name": "Hi-C alignments on Curated Assembly" + }, + "map_qual": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4539.320684140101, + "top": 1068.4493796772103 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + }, + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "056f86469460", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.3+galaxy0", + "type": "tool", + "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", + "when": null, + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "errors": null, + "id": 22, + "input_connections": { + "input": { + "id": 14, + "output_name": "Hi-C alignments on Curated Assembly" + }, + "map_qual": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": "PretextMap for snapshot if High res", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4562.93925347705, + "top": 1623.1092249969438 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + }, + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "056f86469460", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.3+galaxy0", + "type": "tool", + "uuid": "88063aa8-5abd-4d00-a400-713276d6aa37", + "when": null, + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "errors": null, + "id": 23, + "input_connections": { + "bamfiles": { + "id": 16, + "output_name": "alignment_output" + }, + "when": { + "id": 15, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 2485.364013425041, + "top": 2443.92687885208 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "c8bc9d08b0e3", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "48c3b202-85ca-447b-8f91-fbc440e33366", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "24": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 24, + "input_connections": { + "input": { + "id": 16, + "output_name": "alignment_output" + }, + "when": { + "id": 15, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 2485.165845830197, + "top": 2752.7109014217717 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "72de31ed-6ef4-4f67-9150-459573b7e7e5", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 25, + "input_connections": { + "input": { + "id": 17, + "output_name": "terminal_telomeres" + } + }, + "inputs": [], + "label": "Select Q telomeres", + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2714.4971761332267, + "top": 1336.8033860991509 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:q" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c5=='q'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "53ab0338-b786-4af7-b842-fcbf276181e9", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 26, + "input_connections": { + "input": { + "id": 17, + "output_name": "terminal_telomeres" + } + }, + "inputs": [], + "label": "Select P telomeres", + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2711.9856839761055, + "top": 1689.7445778762724 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:p" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c5=='p'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "fad7b2b6-e2b2-4d73-bb6b-4f57a43d1139", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 27, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 13, + "output_name": "Genes track" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 18, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2941.718456268684, + "top": 354.18401973486885 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "b7fc2c41-f13a-4f26-b5e9-b42420e6265c", + "when": null, + "workflow_outputs": [] + }, + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 28, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 20, + "output_name": "pretext_map_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 19, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Pretext Map for Snapshot", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5174.629561215213, + "top": 719.5042763958141 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e0bcecd0-34a9-4991-b90c-7fca70edba91", + "when": null, + "workflow_outputs": [] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 29, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 22, + "output_name": "pretext_map_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 21, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Pretext Map for Snapshot 2", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5148.343164860567, + "top": 1690.4622107945054 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "33ed6bb4-16d1-4bba-b5cb-64c61a39df91", + "when": null, + "workflow_outputs": [] + }, + "30": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 30, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 23, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 24, + "output_name": "output" + } + }, + "inputs": [], + "label": "Hifi Alignments", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2757.343972549042, + "top": 2618.950853641779 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "${Haplotype} Merged HiFi Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merge_hifi_align_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2afb1f1a-4687-4c63-9496-d66c63c23a01", + "when": null, + "workflow_outputs": [ + { + "label": "Merged HiFi Alignments", + "output_name": "data_param", + "uuid": "b0149c13-2ddf-4fb1-9939-5d38c8a98312" + } + ] + }, + "31": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 31, + "input_connections": { + "input": { + "id": 25, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Q telomere BED", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2970.821115983621, + "top": 1389.389394153961 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "${Haplotype} Q telomeres BED" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "q_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "d443834e-e460-4410-ba40-345ba9a25851", + "when": null, + "workflow_outputs": [ + { + "label": "Q telomeres BED", + "output_name": "out_file1", + "uuid": "b9b7d743-5f41-49f3-a640-5a68ee3a63a4" + } + ] + }, + "32": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 32, + "input_connections": { + "input": { + "id": 26, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "P telomere BED", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2973.6398415695585, + "top": 1613.195546497711 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "${Haplotype} P telomeres BED" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "p_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "49497ce7-bb24-4891-b36a-234feb07f389", + "when": null, + "workflow_outputs": [ + { + "label": "P telomeres BED", + "output_name": "out_file1", + "uuid": "4b23fce7-a313-42ef-b365-783ee0bd24e6" + } + ] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "errors": null, + "id": 33, + "input_connections": { + "input": { + "id": 28, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 6685.6783533422185, + "top": 630.7324027014515 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "tool_shed_repository": { + "changeset_revision": "ff02cf8f66f0", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.5+galaxy1", + "type": "tool", + "uuid": "f453794e-4045-4602-9f49-26abf7f1426f", + "when": null, + "workflow_outputs": [] + }, + "34": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "errors": null, + "id": 34, + "input_connections": { + "input": { + "id": 29, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 6532.174037677532, + "top": 1716.6436808211497 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "tool_shed_repository": { + "changeset_revision": "ff02cf8f66f0", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.5+galaxy1", + "type": "tool", + "uuid": "533b33d8-3a3b-480a-9978-1526d65606c5", + "when": null, + "workflow_outputs": [] + }, + "35": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", + "errors": null, + "id": 35, + "input_connections": { + "bamInput": { + "id": 30, + "output_name": "data_param" + }, + "binSize": { + "id": 10, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "bamCoverage", + "outputs": [ + { + "name": "outFileName", + "type": "bigwig" + } + ], + "position": { + "left": 3016.623882825025, + "top": 2500.1566619198493 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "${Haplotype} BigWig Coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "coverage" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "0e49b109abc2", + "name": "deeptools_bam_coverage", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"no\", \"__current_case__\": 0}, \"bamInput\": {\"__class__\": \"ConnectedValue\"}, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"exactScaling\": false, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"scaling\": {\"type\": \"no\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "43e863a6-80b4-4c02-a249-ca7a6469ac01", + "when": null, + "workflow_outputs": [ + { + "label": "BigWig Coverage", + "output_name": "outFileName", + "uuid": "99e50ff7-22ae-4afc-af83-e81b69c73931" + } + ] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", + "errors": null, + "id": 36, + "input_connections": { + "input_bams": { + "id": 30, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Samtools depth", + "outputs": [ + { + "name": "output", + "type": "tabular" + } + ], + "position": { + "left": 3018.599013311725, + "top": 2773.899559556594 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "fb6d5ffc365f", + "name": "samtools_depth", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__input_ext\": \"input\", \"additional_options\": {\"required_flags\": null, \"skipped_flags\": [\"4\", \"256\", \"512\", \"1024\"], \"deletions\": false, \"single_read\": false}, \"all\": \"-a\", \"basequality\": null, \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"mapquality\": null, \"maxdepth\": null, \"minlength\": null, \"output_options\": {\"header\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "75e128e1-596f-4804-9d3d-2788ee7bf5b3", + "when": null, + "workflow_outputs": [] + }, + "37": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 37, + "input_connections": { + "input1": { + "id": 31, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Test if Q telomere track is empty", + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 3232.9042274387793, + "top": 1336.2468886682436 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "5a566197-db33-422e-8629-116adda07abc", + "when": null, + "workflow_outputs": [] + }, + "38": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 38, + "input_connections": { + "input1": { + "id": 32, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Test if P telomere track is empty", + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 3248.092100481099, + "top": 1707.4082913428974 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "abb3fd29-c4ee-44e6-82ec-7e3d928501e8", + "when": null, + "workflow_outputs": [] + }, + "39": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 39, + "input_connections": { + "input": { + "id": 33, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 7085.848256831036, + "top": 687.0538296553776 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "png" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "${Haplotype} Pretext Snapshot - Multimapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_img_multimapping" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "7815d57b-da36-42a2-b25c-4cf3dbf89c69", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Snapshot - Multimapping", + "output_name": "output", + "uuid": "e6ff4346-6a00-4142-9d43-384b46a44975" + } + ] + }, + "40": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 40, + "input_connections": { + "input": { + "id": 34, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 6945.030919069612, + "top": 1655.2532643101972 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "png" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "${Haplotype} Pretext Snapshot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_img_coverage" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "1a9ded49-abf8-425f-b4a2-abcbcb537aa0", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Snapshot", + "output_name": "output", + "uuid": "8f3a0981-dde7-4e36-aee0-37882dbc6a35" + } + ] + }, + "41": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 41, + "input_connections": { + "input": { + "id": 35, + "output_name": "outFileName" + }, + "pretext": { + "id": 21, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Add Coverage Track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4692.507344884729, + "top": 1401.7505154389646 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "68583f52-0bd8-41b4-8f10-0bd0ed274177", + "when": null, + "workflow_outputs": [] + }, + "42": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 42, + "input_connections": { + "input": { + "id": 35, + "output_name": "outFileName" + }, + "pretext": { + "id": 19, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Add Coverage Track - Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4930.873150728038, + "top": 522.7504531561559 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "fd4f30e5-128b-4a4d-b9f6-2239323f99da", + "when": null, + "workflow_outputs": [] + }, + "43": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 43, + "input_connections": { + "input": { + "id": 36, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3237.9830709863745, + "top": 2797.3439573103838 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"__input_ext\": \"tabular\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond\": \"c3==0\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "58778da7-33dd-41a1-a2e3-f129e95f3e2e", + "when": null, + "workflow_outputs": [] + }, + "44": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 44, + "input_connections": { + "input_param_type|input_param": { + "id": 37, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "False if Q telomere track is empty", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3533.910131828852, + "top": 1421.1620265654865 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e6ed80e6-3b95-4f21-b6a6-3c6b494d900e", + "when": null, + "workflow_outputs": [] + }, + "45": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 45, + "input_connections": { + "input_param_type|input_param": { + "id": 38, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "False if P telomere track is empty", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3538.369887065075, + "top": 1630.9122923041941 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "1659cc59-1a57-4b1f-a6e0-722ac88f1b18", + "when": null, + "workflow_outputs": [] + }, + "46": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "errors": null, + "id": 46, + "input_connections": { + "input": { + "id": 43, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3437.9830709863745, + "top": 2517.3439573103838 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "tool_shed_repository": { + "changeset_revision": "aff5135563c6", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"c2-1\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.1", + "type": "tool", + "uuid": "28ba3827-13c9-431f-b02c-01904a6f0577", + "when": null, + "workflow_outputs": [] + }, + "47": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 47, + "input_connections": { + "input": { + "id": 32, + "output_name": "out_file1" + }, + "pretext": { + "id": 42, + "output_name": "graph_out" + }, + "when": { + "id": 45, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Add p telomere track Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4933.51724185973, + "top": 159.49598879016884 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"p_telomeres_gap_format\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "57e1a280-5445-4866-9963-fe6a92cc4b56", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "48": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 48, + "input_connections": { + "input": { + "id": 32, + "output_name": "out_file1" + }, + "pretext": { + "id": 41, + "output_name": "graph_out" + }, + "when": { + "id": 45, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Add p telomere track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4874.351579055826, + "top": 1106.9504024326575 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"p_telomeres_gap_format\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "288ab63e-6d67-4aef-a044-127c2879d5d6", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "49": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 49, + "input_connections": { + "input": { + "id": 46, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 3550.7884845286626, + "top": 2755.836786508236 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"__input_ext\": \"tabular\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"columnList\": \"c1,c4,c2,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "a216faae-22b0-4592-86ab-a86ebc4b6c4f", + "when": null, + "workflow_outputs": [] + }, + "50": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 50, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 47, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 42, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5252.120524506072, + "top": 549.225398130873 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "09b9cf21-e55a-4847-979d-9b3628fd0945", + "when": null, + "workflow_outputs": [] + }, + "51": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 51, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 48, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 41, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5110.241409174444, + "top": 1294.7032594301413 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "5cd17378-083f-40bb-b4d7-90e7acd1e2a1", + "when": null, + "workflow_outputs": [] + }, + "52": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1+galaxy2", + "errors": null, + "id": 52, + "input_connections": { + "input": { + "id": 49, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "bedtools MergeBED", + "outputs": [ + { + "name": "output", + "type": "bed" + } + ], + "position": { + "left": 3747.9765625, + "top": 2497.9921875 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "${Haplotype} Coverage gap BED for JBrowse2" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1+galaxy2", + "tool_shed_repository": { + "changeset_revision": "2892111d91f8", + "name": "bedtools", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__input_ext\": \"input\", \"c_and_o_argument_repeat\": [], \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"distance\": \"0\", \"header\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"strand\": \"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.31.1+galaxy2", + "type": "tool", + "uuid": "b5d7304d-f565-4fb3-b5be-4dac146f1048", + "when": null, + "workflow_outputs": [ + { + "label": "Coverage gap BED for JBrowse2", + "output_name": "output", + "uuid": "fcc571fa-7293-4ad8-8d45-fe587d6a4033" + } + ] + }, + "53": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 53, + "input_connections": { + "input": { + "id": 31, + "output_name": "out_file1" + }, + "pretext": { + "id": 50, + "output_name": "data_param" + }, + "when": { + "id": 44, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Add q telomere track Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 5370.015339788395, + "top": 190.4950174550865 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"q_telomeres_gap_format\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "a9aac982-2e34-432f-9a3a-a4a7e131021e", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "54": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 54, + "input_connections": { + "input": { + "id": 31, + "output_name": "out_file1" + }, + "pretext": { + "id": 51, + "output_name": "data_param" + }, + "when": { + "id": 44, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Add q telomere track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 5443.457771166481, + "top": 1258.386593440754 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"q_telomeres_gap_format\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "5fdfacdd-5f78-4410-817e-217a31ca9744", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "55": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "errors": null, + "id": 55, + "input_connections": { + "input": { + "id": 52, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3884.915154443368, + "top": 2736.390580341113 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "${Haplotype} Coverage Gaps Track" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "coverage_gaps" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "tool_shed_repository": { + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"exp\": \"200\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.1", + "type": "tool", + "uuid": "3db60934-ad45-4089-bfc2-d4805cfa2bc5", + "when": null, + "workflow_outputs": [ + { + "label": "Coverage Gaps Track", + "output_name": "out_file1", + "uuid": "cf85bc54-e8bc-4bca-9a2b-8a068c6f2145" + } + ] + }, + "56": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 56, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 53, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 50, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5610.682959586507, + "top": 561.0043753333345 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "53cee6ad-229f-44a6-8e5b-a5228f6f5d92", + "when": null, + "workflow_outputs": [] + }, + "57": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 57, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 54, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 51, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5500.076504259661, + "top": 1642.3338172460126 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "81e184d9-ba58-4fae-87fb-11c4fa6eced3", + "when": null, + "workflow_outputs": [] + }, + "58": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 58, + "input_connections": { + "input": { + "id": 18, + "output_name": "out_file1" + }, + "pretext": { + "id": 56, + "output_name": "data_param" + } + }, + "inputs": [], + "label": "Add gaps track - Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 5845.822027381051, + "top": 342.5136042491993 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "d1ff78bd-39bb-49b6-956f-873f02e58e3d", + "when": null, + "workflow_outputs": [] + }, + "59": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 59, + "input_connections": { + "input": { + "id": 18, + "output_name": "out_file1" + }, + "pretext": { + "id": 57, + "output_name": "data_param" + } + }, + "inputs": [], + "label": "Add gaps track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 5792.819827825169, + "top": 1450.0886244258331 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "cdf721aa-3c39-4d9d-8bd6-704f391a0cca", + "when": null, + "workflow_outputs": [] + }, + "60": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 60, + "input_connections": { + "input": { + "id": 55, + "output_name": "out_file1" + }, + "pretext": { + "id": 58, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": "Add coverage gaps track - Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 6135.125914098252, + "top": 636.2050530086793 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage_gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "cc0f0fe6-c04c-4e43-b631-cf9afefc2637", + "when": null, + "workflow_outputs": [] + }, + "61": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 61, + "input_connections": { + "input": { + "id": 55, + "output_name": "out_file1" + }, + "pretext": { + "id": 59, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": "Add coverage gaps track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 6109.043832195717, + "top": 1599.1026528213733 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage_gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "a942c184-269c-47f5-8bb3-3643d26c1783", + "when": null, + "workflow_outputs": [] + }, + "62": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 62, + "input_connections": { + "input": { + "id": 27, + "output_name": "data_param" + }, + "pretext": { + "id": 60, + "output_name": "graph_out" + }, + "when": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": "Add gene track - Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 6443.940619831165, + "top": 195.40177372991369 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"genes_as_gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "50f15ef0-88bf-4c6e-b694-c5a18f884edc", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "63": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 63, + "input_connections": { + "input": { + "id": 27, + "output_name": "data_param" + }, + "pretext": { + "id": 61, + "output_name": "graph_out" + }, + "when": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": "Add genes track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 6389.009033248582, + "top": 1135.9412046475013 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"genes_as_gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "f99384e5-6b53-433c-b05c-d043c059707e", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "64": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 64, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 62, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 60, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 6868.554855871704, + "top": 245.5774372975351 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "${Haplotype} Pretext All tracks - Multimapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "pretext_all_tracks_multimapping" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "8f236853-0025-4f21-98ba-fc31812fcef7", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext All tracks - Multimapping", + "output_name": "data_param", + "uuid": "bac19013-cc4e-4587-ae55-aee6d42559fa" + } + ] + }, + "65": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 65, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 63, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 61, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 6912.386698431452, + "top": 1204.9547023974224 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "${Haplotype} Pretext All tracks" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "pretext_all_tracks" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "998eaa78-1fb7-4f94-a8fc-f666e7e305ba", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext All tracks", + "output_name": "data_param", + "uuid": "bf621bf4-69d2-4bad-895a-526c53b97736" + } + ] + } + }, + "tags": [], + "uuid": "5c1fd61c-b246-4333-a8f5-fc7a70207ffb" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "240ab5d6-83d6-4062-af99-a9d9a346947b", + "when": null, + "workflow_outputs": [ + { + "label": "Hap1 BigWig Coverage", + "output_name": "BigWig Coverage", + "uuid": "7cac036c-4794-4d60-b1e0-12778f7908f4" + }, + { + "label": "Hap1 Pretext Snapshot - Multimapping", + "output_name": "Pretext Snapshot - Multimapping", + "uuid": "58f18363-e9c0-4857-857d-0dffd1f157b3" + }, + { + "label": "Hap1 Coverage gap BED for JBrowse2", + "output_name": "Coverage gap BED for JBrowse2", + "uuid": "de1149ed-b3f4-4426-b824-f52392e943aa" + }, + { + "label": "Hap1 Coverage Gaps Track", + "output_name": "Coverage Gaps Track", + "uuid": "f0d01655-4d30-47cf-8044-b1e9108a3f69" + }, + { + "label": "Hap1 Pretext All tracks - Multimapping", + "output_name": "Pretext All tracks - Multimapping", + "uuid": "95ada9d2-897f-4de8-be11-21c2e8c4f8ca" + }, + { + "label": "Hap1 Pretext All tracks", + "output_name": "Pretext All tracks", + "uuid": "0877c216-364f-4112-8338-9601f2417fb3" + }, + { + "label": "Hap1 Gaps BED", + "output_name": "Gaps BED", + "uuid": "e50935d8-ba89-41d2-baa1-e783c475893a" + }, + { + "label": "Hap1 miniprot", + "output_name": "miniprot", + "uuid": "b0ffea0c-a44c-4750-9b0d-8383bf6e77cd" + }, + { + "label": "Hap1 Compleasm Summary", + "output_name": "Compleasm Summary", + "uuid": "7cc92b5e-8e46-4763-9235-b69eb4289141" + }, + { + "label": "Hap1 Genes track", + "output_name": "Genes track", + "uuid": "e0c04b13-f4fa-4b19-adb2-4131c194365c" + }, + { + "label": "Hap1 Pairtools MultiQC on Curated Assembly: Plots", + "output_name": "Pairtools MultiQC on Curated Assembly: Plots", + "uuid": "b0b6c19f-517b-448a-a4a7-86192afe4916" + }, + { + "label": "Hap1 Merged Hi-C Alignments on Curated Assembly", + "output_name": "Merged Hi-C Alignments on Curated Assembly", + "uuid": "3090ad53-6803-4990-b86c-c52466c5a11a" + }, + { + "label": "Hap1 Hi-C duplication stats on Curated Assembly", + "output_name": "Hi-C duplication stats on Curated Assembly", + "uuid": "f602b75d-9d00-4e72-9ff6-cccfd37799d7" + }, + { + "label": "Hap1 Hi-C duplication stats on Curated Assembly: Raw", + "output_name": "Hi-C duplication stats on Curated Assembly: Raw", + "uuid": "50516d37-b12c-446d-859d-7dd54a3674fa" + }, + { + "label": "Hap1 Hi-C alignments on Curated Assembly", + "output_name": "Hi-C alignments on Curated Assembly", + "uuid": "1b2e3d26-1634-4b63-8446-5dcb6f6f77db" + }, + { + "label": "Hap1 Hi-C duplication stats on Curated Assembly: MultiQC", + "output_name": "Hi-C duplication stats on Curated Assembly: MultiQC", + "uuid": "649b862b-789c-4bf7-b308-276d1c0b6239" + }, + { + "label": "Hap1 Pairtools MultiQC Stats on Curated Assembly", + "output_name": "Pairtools MultiQC Stats on Curated Assembly", + "uuid": "aaa74bdb-44da-4639-9555-e5190fda4141" + }, + { + "label": "Hap1 Telomere Report", + "output_name": "Telomere Report", + "uuid": "73203ee9-073a-4073-92b8-be8a5fdeb0d3" + }, + { + "label": "Hap1 terminal telomeres", + "output_name": "terminal telomeres", + "uuid": "5410d87b-ee50-4c08-a243-cbe782e90973" + }, + { + "label": "Hap1 Gaps BEDgraph", + "output_name": "Gaps BEDgraph", + "uuid": "dea070eb-6ae7-430c-be74-d5013cb625af" + }, + { + "label": "Hap1 Merged HiFi Alignments", + "output_name": "Merged HiFi Alignments", + "uuid": "2aab2732-fbc2-4bd8-975a-448f4d6d2a66" + }, + { + "label": "Hap1 Q telomeres BED", + "output_name": "Q telomeres BED", + "uuid": "729202a1-b2dd-4be8-b3ea-2cffc5bbf324" + }, + { + "label": "Hap1 Pretext Snapshot", + "output_name": "Pretext Snapshot", + "uuid": "897cee4a-6b2a-4ba9-b879-81d77b41d80a" + }, + { + "label": "Hap1 P telomeres BED", + "output_name": "P telomeres BED", + "uuid": "643473fc-c1a1-4b59-b97c-c88c187d1ea0" + } + ] + }, + "27": { + "annotation": "", + "id": 27, + "input_connections": { + "Bin Size for BigWig files": { + "id": 14, + "input_subworkflow_step_id": 10, + "output_name": "output" + }, + "Canonical telomeric pattern": { + "id": 11, + "input_subworkflow_step_id": 8, + "output_name": "output" + }, + "Database for Compleasm Genes": { + "id": 5, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Generate Gene Tracks with Compleasm?": { + "id": 3, + "input_subworkflow_step_id": 3, + "output_name": "output" + }, + "Generate high resolution Hi-C maps?": { + "id": 15, + "input_subworkflow_step_id": 11, + "output_name": "output" + }, + "Haplotype": { + "id": 17, + "input_subworkflow_step_id": 2, + "output_name": "output" + }, + "Haplotype fasta": { + "id": 20, + "input_subworkflow_step_id": 1, + "output_name": "Curated Hap2" + }, + "Hi-C reads": { + "id": 24, + "input_subworkflow_step_id": 4, + "output_name": "data_param" + }, + "Minimum Mapping Quality": { + "id": 13, + "input_subworkflow_step_id": 5, + "output_name": "output" + }, + "PacBio reads": { + "id": 25, + "input_subworkflow_step_id": 7, + "output_name": "data_param" + }, + "Remove duplicated Hi-C reads?": { + "id": 8, + "input_subworkflow_step_id": 6, + "output_name": "output" + }, + "Telomere patterns to explore (comma-separated), IUPAC allowed": { + "id": 12, + "input_subworkflow_step_id": 9, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "", + "name": "Hic Map Hap2" + } + ], + "label": "Hic Map Hap2", + "name": "Post Curation 1 haplotype", + "outputs": [], + "position": { + "left": 2453.771158175059, + "top": 0 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [ + { + "child_steps": [ + 19, + 20, + 28, + 33, + 39, + 42, + 47, + 50, + 53, + 56, + 58, + 62, + 64, + 60 + ], + "color": "none", + "data": { + "title": "Generate Pretext Maps and Tracks - Multimapping" + }, + "id": 5, + "position": [ + 4494.9, + 115.7 + ], + "size": [ + 3564, + 773 + ], + "type": "frame" + }, + { + "child_steps": [ + 17, + 25, + 26, + 31, + 32, + 37, + 38, + 44, + 45 + ], + "color": "lime", + "data": { + "title": "Telomeres" + }, + "id": 3, + "position": [ + 2425.542990374414, + 1275.4 + ], + "size": [ + 1479, + 607 + ], + "type": "frame" + }, + { + "child_steps": [ + 21, + 22, + 29, + 34, + 40, + 41, + 48, + 51, + 54, + 57, + 59, + 61, + 63, + 65 + ], + "color": "orange", + "data": { + "title": "Add tracks to the Hi-C map - MAPQ filtering" + }, + "id": 6, + "position": [ + 4478.6, + 996 + ], + "size": [ + 3239, + 908 + ], + "type": "frame" + }, + { + "child_steps": [ + 16, + 23, + 24, + 30, + 35, + 36, + 43, + 46, + 49, + 52, + 55 + ], + "color": "green", + "data": { + "title": "Coverage" + }, + "id": 4, + "position": [ + 2215.442990374414, + 2411.7000000000003 + ], + "size": [ + 2060, + 530 + ], + "type": "frame" + }, + { + "child_steps": [ + 13, + 27 + ], + "color": "turquoise", + "data": { + "title": "Egapx Annotations" + }, + "id": 1, + "position": [ + 1870.642990374414, + 0 + ], + "size": [ + 1514, + 679 + ], + "type": "frame" + }, + { + "child_steps": [ + 12, + 18 + ], + "color": "red", + "data": { + "title": "Gaps" + }, + "id": 2, + "position": [ + 2202.6, + 764.8 + ], + "size": [ + 542, + 213 + ], + "type": "frame" + }, + { + "child_steps": [ + 14 + ], + "color": "yellow", + "data": { + "title": "Trim and align Hi-C reads" + }, + "id": 0, + "position": [ + 1320.042990374414, + 1132.8000000000002 + ], + "size": [ + 910, + 990 + ], + "type": "frame" + } + ], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Post Curation 1 haplotype", + "report": { + "markdown": "# Precuration workflow on:\n\n```galaxy\nhistory_dataset_embedded(output=\"Assembly Info\")\n```\n\n## Duplication Stats\n\nMarkduplicate deduplication stats (if applicable)\n\n```galaxy\nhistory_dataset_embedded(output=\"Markduplicates Summary\")\n```\n\nPairtools stats\n```galaxy\nhistory_dataset_as_table(output=\"Hi-C duplication stats: MultiQC\")\n```\n\n\n## Pretext Snapshots\n\nWith Multimapping\n\n\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot - Multimapping\")\n```\n\n\nWith MAPQ filtering\n```galaxy\nhistory_dataset_as_image(output=\"Pretext Snapshot\")\n```\n\n\n\n\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Database for Compleasm Genes" + } + ], + "label": "Database for Compleasm Genes", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 0, + "top": 182.19274222599256 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "c5aa113e-5a56-4b29-8d56-6c1eb8a3fd25", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Haplotype fasta" + } + ], + "label": "Haplotype fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 52.49787906257684, + "top": 280.38975521515187 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "00b7518c-0935-4e68-a6e4-82179a35404a", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Haplotype" + } + ], + "label": "Haplotype", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 104.44344666958791, + "top": 446.2752821316836 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "f84e044d-8247-4c4d-a554-3a684fba2914", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Generate Gene Tracks with Compleasm?" + } + ], + "label": "Generate Gene Tracks with Compleasm?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 197.32514678734688, + "top": 603.2273611572942 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "5415eba3-fd92-40fc-a888-e9d7ee08ecd2", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "Collection containing the Hi-C reads. ", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "Collection containing the Hi-C reads. ", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 252.41826753913148, + "top": 870.7233163408231 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "42ec35b8-88d2-4390-a134-8fbd25142973", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 20 ", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "Minimum mapping score to keep for Hi-C alignments for the quality filtered PretextMap. Set to 0 to keep all mapped reads. Default: 20 ", + "name": "Minimum Mapping Quality" + } + ], + "label": "Minimum Mapping Quality", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 355.85421204811183, + "top": 1093.2951880767228 + }, + "tool_id": null, + "tool_state": "{\"default\": 10, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "cd8cc71f-d3b4-4251-8078-e6fad5337261", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Remove duplicated Hi-C reads?" + } + ], + "label": "Remove duplicated Hi-C reads?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 410.0429063272865, + "top": 1218.4113822445638 + }, + "tool_id": null, + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "a38c23e6-55ec-4178-a127-e907d4395c25", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "PacBio reads" + } + ], + "label": "PacBio reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 469.16532647310174, + "top": 1391.176617378092 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "8bc4fc4e-1a1a-43e8-b4bc-5115fefb541d", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "The default value is set for vertebrate genomes (CCCTAA).", + "content_id": null, + "errors": null, + "id": 8, + "input_connections": {}, + "inputs": [ + { + "description": "The default value is set for vertebrate genomes (CCCTAA).", + "name": "Canonical telomeric pattern" + } + ], + "label": "Canonical telomeric pattern", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 543.9849789808709, + "top": 1511.1007389804276 + }, + "tool_id": null, + "tool_state": "{\"default\": \"TTAGGG\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "84c91e14-1709-4602-8771-eea1dadf471b", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 9, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Telomere patterns to explore (comma-separated), IUPAC allowed" + } + ], + "label": "Telomere patterns to explore (comma-separated), IUPAC allowed", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 668.2666309067496, + "top": 1679.641738264636 + }, + "tool_id": null, + "tool_state": "{\"default\": \"TTAGGG,CCCTAA\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "aedd2336-53ba-4d1d-9e82-56bc7fa929bf", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 10, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Bin Size for BigWig files" + } + ], + "label": "Bin Size for BigWig files", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 787.089494227972, + "top": 1849.203070097743 + }, + "tool_id": null, + "tool_state": "{\"default\": 100, \"validators\": [{\"min\": null, \"max\": null, \"negate\": false, \"type\": \"in_range\"}], \"parameter_type\": \"integer\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "52873498-7180-4050-82a3-58837bff2d87", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 11, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Generate high resolution Hi-C maps?" + } + ], + "label": "Generate high resolution Hi-C maps?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 890.5293322248995, + "top": 1994.7404317039259 + }, + "tool_id": null, + "tool_state": "{\"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "0f0df32f-53bf-4a2d-8931-191f8ec5b4c4", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "errors": null, + "id": 12, + "input_connections": { + "input_file": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "gfastats", + "outputs": [ + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2242.2245339478322, + "top": 819.2167640182922 + }, + "post_job_actions": { + "ChangeDatatypeActionstats": { + "action_arguments": { + "newtype": "bed" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "stats" + }, + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "${Haplotype} Gaps BED" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "Gaps_bed" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.11+galaxy2", + "tool_shed_repository": { + "changeset_revision": "10dc0f5a82e2", + "name": "gfastats", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_file\": {\"__class__\": \"ConnectedValue\"}, \"mode_condition\": {\"selector\": \"statistics\", \"__current_case__\": 1, \"statistics_condition\": {\"selector\": \"coordinates\", \"__current_case__\": 1, \"out_coord\": \"g\"}, \"locale\": false, \"tabular\": true, \"discover_paths\": false}, \"target_condition\": {\"target_option\": \"false\", \"__current_case__\": 0}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.11+galaxy2", + "type": "tool", + "uuid": "7ef0994f-1ebf-4d9d-8799-cd6f42cb0c0c", + "when": null, + "workflow_outputs": [ + { + "label": "Gaps BED", + "output_name": "stats", + "uuid": "4a7f2ef2-c635-4ddb-b23b-8546f9290ef9" + } + ] + }, + "13": { + "annotation": "", + "id": 13, + "input_connections": { + "Database for Compleasm Genes": { + "id": 0, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Haplotype fasta": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "when": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Generate Compleasm Gene Track", + "outputs": [], + "position": { + "left": 2274.7101468393334, + "top": 224.51855946581205 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [ + { + "child_steps": [ + 2, + 3, + 4, + 5 + ], + "color": "turquoise", + "data": { + "title": "Egapx Annotations" + }, + "id": 0, + "position": [ + 241.15428294247886, + 0 + ], + "size": [ + 1514, + 679 + ], + "type": "frame" + } + ], + "format-version": "0.1", + "name": "Generate Compleasm Gene Track", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Haplotype fasta" + } + ], + "label": "Haplotype fasta", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 266.4630172025337 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"format\": [\"fasta\"], \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "68575318-3e76-4941-98f0-02eea53845cb", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Database for Compleasm Genes" + } + ], + "label": "Database for Compleasm Genes", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 2.984821764465323, + "top": 386.30643645389887 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "23900e15-92df-4f0f-b8f2-74872cc57dc1", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "errors": null, + "id": 2, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + }, + "lineage_dataset": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "compleasm", + "outputs": [ + { + "name": "full_table_busco", + "type": "tsv" + }, + { + "name": "miniprot", + "type": "gff3" + }, + { + "name": "summary", + "type": "txt" + } + ], + "position": { + "left": 560.0669948496356, + "top": 228.2562538342695 + }, + "post_job_actions": { + "HideDatasetActionfull_table_busco": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "full_table_busco" + }, + "HideDatasetActionminiprot": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "miniprot" + }, + "RenameDatasetActionsummary": { + "action_arguments": { + "newname": "${Haplotype} Compleasm Summary" + }, + "action_type": "RenameDatasetAction", + "output_name": "summary" + }, + "TagDatasetActionsummary": { + "action_arguments": { + "tags": "compleasm_summary" + }, + "action_type": "TagDatasetAction", + "output_name": "summary" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/compleasm/compleasm/0.2.6+galaxy3", + "tool_shed_repository": { + "changeset_revision": "fc7334661489", + "name": "compleasm", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"busco_database\": \"v5\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"lineage_dataset\": {\"__class__\": \"ConnectedValue\"}, \"mode\": \"busco\", \"outputs\": [\"full_table_busco\", \"miniprot\", \"summary\"], \"specified_contigs\": null, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.6+galaxy3", + "type": "tool", + "uuid": "5d392bdf-4fd3-433d-a38d-cb680f742cfb", + "when": null, + "workflow_outputs": [ + { + "label": "Compleasm Summary", + "output_name": "summary", + "uuid": "7607b4eb-0ae4-46c8-8456-d226a22f5ad4" + }, + { + "label": "miniprot", + "output_name": "miniprot", + "uuid": "2310c55a-eb57-4779-9183-a5bfaee21947" + } + ] + }, + "3": { + "annotation": "", + "content_id": "gff2bed1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "miniprot" + } + }, + "inputs": [], + "label": null, + "name": "GFF-to-BED", + "outputs": [ + { + "name": "out_file1", + "type": "bed" + } + ], + "position": { + "left": 888.1010300332687, + "top": 454.0897176874731 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "gff2bed1", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.1", + "type": "tool", + "uuid": "5d5edff4-0c51-4cd2-9433-43b752f1460c", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 4, + "input_connections": { + "input": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 1177.3320452520443, + "top": 239.10806772114108 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "1e143b84-a21d-4401-9025-c3c79912f371", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "errors": null, + "id": 5, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1342.90747480956, + "top": 447.3406434911534 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Genes track" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "gene_track" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "tool_shed_repository": { + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"exp\": \"200\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.1", + "type": "tool", + "uuid": "f1878a29-df66-4aa6-96ab-28e5b6d8bff6", + "when": null, + "workflow_outputs": [ + { + "label": "Genes track", + "output_name": "out_file1", + "uuid": "b3dda081-662f-44d9-8ada-92f53536e892" + } + ] + } + }, + "tags": [], + "uuid": "f0ee0749-4613-47ca-88a0-11e7228a6557" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "0514d7a4-a26d-4e74-8a9b-3a0341d52312", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "Genes track", + "output_name": "Genes track", + "uuid": "8b1f9cee-cb6d-439e-bcf7-fdcc771723a8" + }, + { + "label": "Compleasm Summary", + "output_name": "Compleasm Summary", + "uuid": "46239fdd-42cd-41c4-9097-eee0b35d5371" + }, + { + "label": "miniprot", + "output_name": "miniprot", + "uuid": "c9366441-f60d-424f-903e-42c05fcb90c5" + } + ] + }, + "14": { + "annotation": "", + "id": 14, + "input_connections": { + "Hi-C reads": { + "id": 4, + "input_subworkflow_step_id": 1, + "output_name": "output" + }, + "Reference": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + }, + "Remove HiC duplicates ?": { + "id": 6, + "input_subworkflow_step_id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Trim, Align, deduplicate Hi-C - Post-curation", + "outputs": [], + "position": { + "left": 1592.404466193863, + "top": 1296.6364383923997 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6228-2785", + "name": "Patrik Smeds" + }, + { + "class": "Person", + "identifier": "https://orcid.org/0000-0001-6421-3484", + "name": "Delphine Lariviere" + } + ], + "format-version": "0.1", + "license": "MIT", + "name": "Trim, Align, deduplicate Hi-C - Post-curation", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Assembly for Haplotype 1.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Assembly for Haplotype 1.", + "name": "Reference" + } + ], + "label": "Reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 19.61889440014272, + "top": 296.72393325180246 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "fa895dbf-8f06-4728-ac6c-d526fcff2578", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Hi-C reads" + } + ], + "label": "Hi-C reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 676.2512666175143 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "a381377e-3cd7-4ed0-b7ed-8f5ddcedcb6e", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Remove HiC duplicates ?" + } + ], + "label": "Remove HiC duplicates ?", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 36.63867101835399, + "top": 821.9062390635704 + }, + "tool_id": null, + "tool_state": "{\"default\": true, \"validators\": [], \"parameter_type\": \"boolean\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "0bae4fec-19e6-4ee8-a9ad-275f8645feec", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "errors": null, + "id": 3, + "input_connections": { + "reference": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2 indexer", + "outputs": [ + { + "name": "index", + "type": "bwa_mem2_index" + } + ], + "position": { + "left": 449.5276061235436, + "top": 356.5526534419638 + }, + "post_job_actions": { + "HideDatasetActionindex": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "index" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2_idx/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"reference\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "5def9e34-fa09-4977-aa55-aa7fc4f4d46e", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3", + "errors": null, + "id": 4, + "input_connections": { + "infile": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Search in textfiles", + "outputs": [ + { + "name": "output", + "type": "input" + } + ], + "position": { + "left": 1398.2033872739419, + "top": 3.9427453625997657 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy3", + "tool_shed_repository": { + "changeset_revision": "ab83aa685821", + "name": "text_processing", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"case_sensitive\": \"-i\", \"color\": \"NOCOLOR\", \"infile\": {\"__class__\": \"ConnectedValue\"}, \"invert\": \"\", \"lines_after\": \"0\", \"lines_before\": \"0\", \"regex_type\": \"-G\", \"url_paste\": \">\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "9.5+galaxy3", + "type": "tool", + "uuid": "b06586f9-7bb2-469d-87c5-a79ac25c2040", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "id": 5, + "input_connections": { + "0:Input dataset collection": { + "id": 1, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", + "outputs": [], + "position": { + "left": 761.1706984123516, + "top": 865.2761180121176 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "45a60cd2-4176-46d6-9e72-62c4597f00ca", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "False when removal is true", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 2312.6587965954513, + "top": 1420.0180180585944 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"boolean\", \"__current_case__\": 3, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": false, \"to\": \"True\"}, {\"__index__\": 1, \"from\": true, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"input\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0e46e40d-7c7b-4f47-a269-a12807e0b87a", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "errors": null, + "id": 7, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 1, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 3, + "output_name": "index" + } + }, + "inputs": [], + "label": null, + "name": "BWA-MEM2", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 785.005162414401, + "top": 500.770155449531 + }, + "post_job_actions": { + "HideDatasetActionbam_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "bam_output" + }, + "RenameDatasetActionbam_output": { + "action_arguments": { + "newname": "Hi-C Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "bam_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bwa_mem2/bwa_mem2/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "af91699b8d4c", + "name": "bwa_mem2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 4, \"algorithmic_options\": {\"algorithmic_options_selector\": \"set\", \"__current_case__\": 0, \"k\": \"19\", \"w\": \"100\", \"d\": \"100\", \"r\": \"1.5\", \"y\": \"20\", \"c\": \"500\", \"D\": \"0.5\", \"W\": \"0\", \"m\": \"50\", \"S\": true, \"P\": true, \"e\": false}, \"scoring_options\": {\"scoring_options_selector\": \"do_not_set\", \"__current_case__\": 1}, \"io_options\": {\"io_options_selector\": \"set\", \"__current_case__\": 0, \"five\": true, \"q\": false, \"T\": \"30\", \"h\": \"5\", \"a\": false, \"C\": false, \"V\": false, \"Y\": false, \"M\": false, \"K\": null}}, \"fastq_input\": {\"fastq_input_selector\": \"paired_collection\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"iset_stats\": null}, \"output_sort\": \"name\", \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"do_not_set\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "45d2eaea-40f9-461e-bfb0-cadd9b9738b8", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "errors": null, + "id": 8, + "input_connections": { + "bamfile": { + "id": 7, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools fixmate", + "outputs": [ + { + "name": "output", + "type": "qname_sorted.bam" + } + ], + "position": { + "left": 1244.3562505927885, + "top": 490.91412456456 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "qname_sorted.bam" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_fixmate/samtools_fixmate/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "84819580b8a5", + "name": "samtools_fixmate", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addms\": true, \"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"noprop\": false, \"remsec\": false, \"tempcigar\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "1db82bd3-3108-4f39-a0f0-f9e5450e1f4f", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "errors": null, + "id": 9, + "input_connections": { + "input1": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools sort", + "outputs": [ + { + "name": "output1", + "type": "bam" + } + ], + "position": { + "left": 1637.3166686019842, + "top": 519.3556477175839 + }, + "post_job_actions": { + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_sort/samtools_sort/2.0.8", + "tool_shed_repository": { + "changeset_revision": "69dca890852c", + "name": "samtools_sort", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"minhash\": false, \"prim_key_cond\": {\"prim_key_select\": \"\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "5033d744-4b6d-4486-b2ea-732697d51e45", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", + "errors": null, + "id": 10, + "input_connections": { + "chroms_path": { + "id": 4, + "output_name": "output" + }, + "sam_path": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pairtools parse", + "outputs": [ + { + "name": "output_parsed_pairs", + "type": "4dn_pairsam" + }, + { + "name": "parsed_pairs_stats", + "type": "tabular" + } + ], + "position": { + "left": 2275.3946896270036, + "top": 66.3908541727944 + }, + "post_job_actions": { + "HideDatasetActionoutput_parsed_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_parsed_pairs" + }, + "HideDatasetActionparsed_pairs_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "parsed_pairs_stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_parse/pairtools_parse/1.1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "a5876cca7b05", + "name": "pairtools_parse", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"assembly_name\": \"\", \"chroms_path\": {\"__class__\": \"ConnectedValue\"}, \"compress_output\": true, \"drop_readid\": false, \"drop_sam\": true, \"drop_seq\": true, \"max_inter_algn_gap\": \"20\", \"max_molecule_size\": \"2000\", \"min_mapq\": \"1\", \"output_stats\": true, \"sam_path\": {\"__class__\": \"ConnectedValue\"}, \"select_add_columns\": {\"add_columns_selection\": \"no\", \"__current_case__\": 1}, \"sort_output\": true, \"walks_policy\": \"mask\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.3+galaxy6", + "type": "tool", + "uuid": "9205b952-9164-4ba4-9c25-4456a206e12b", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 11, + "input_connections": { + "input": { + "id": 9, + "output_name": "output1" + }, + "when": { + "id": 5, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 1980.8010618435853, + "top": 483.13780589990847 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "22bcd1ca-c4f9-4802-b545-c20f2f7798f4", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "errors": null, + "id": 12, + "input_connections": { + "bamfiles": { + "id": 9, + "output_name": "output1" + }, + "when": { + "id": 5, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 2001.1280622744214, + "top": 775.3922577847298 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "c8bc9d08b0e3", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "03cf4998-54d1-43b4-9005-828e8e1da14c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "errors": null, + "id": 13, + "input_connections": { + "pairs_path": { + "id": 10, + "output_name": "output_parsed_pairs" + } + }, + "inputs": [], + "label": null, + "name": "Pairtools dedup", + "outputs": [ + { + "name": "output_dedup_pairs", + "type": "input" + }, + { + "name": "dedup_pairs_stats", + "type": "tabular" + } + ], + "position": { + "left": 2617.665517793338, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActiondedup_pairs_stats": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "dedup_pairs_stats" + }, + "HideDatasetActionoutput_dedup_pairs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_dedup_pairs" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pairtools_dedup/pairtools_dedup/1.1.3+galaxy6", + "tool_shed_repository": { + "changeset_revision": "3d1d241ceff2", + "name": "pairtools_dedup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"compress_output\": true, \"mark_dups\": true, \"max_mismatch\": \"0\", \"output_bytile_stats\": false, \"output_dups\": false, \"output_stats\": true, \"pairs_path\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.3+galaxy6", + "type": "tool", + "uuid": "222ad224-925a-495f-ab74-44c2fb2af4a4", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 14, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 12, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 11, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2378.5723525329613, + "top": 771.7493692529479 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Merged Hi-C Alignments on Curated Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merged_alignments_scaffolds" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e9571afc-84e8-44b7-a213-8d484124a0bc", + "when": null, + "workflow_outputs": [ + { + "label": "Merged Hi-C Alignments on Curated Assembly", + "output_name": "data_param", + "uuid": "2604d937-9ced-4733-9262-d8ea56c34f1c" + } + ] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", + "errors": null, + "id": 15, + "input_connections": { + "input_tabular": { + "id": 13, + "output_name": "dedup_pairs_stats" + } + }, + "inputs": [], + "label": null, + "name": "Column join", + "outputs": [ + { + "name": "tabular_output", + "type": "tabular" + } + ], + "position": { + "left": 2991.2596185435405, + "top": 513.4889769208286 + }, + "post_job_actions": { + "RenameDatasetActiontabular_output": { + "action_arguments": { + "newname": "Hi-C duplication stats on Curated Assembly: Raw" + }, + "action_type": "RenameDatasetAction", + "output_name": "tabular_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3", + "tool_shed_repository": { + "changeset_revision": "3ddd99c7efee", + "name": "collection_column_join", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fill_char\": \".\", \"has_header\": \"0\", \"identifier_column\": \"1\", \"include_outputs\": null, \"input_tabular\": {\"__class__\": \"ConnectedValue\"}, \"old_col_in_header\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.3", + "type": "tool", + "uuid": "9b13d478-eb6a-410d-9fb0-aa13a4543d0e", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C duplication stats on Curated Assembly: Raw", + "output_name": "tabular_output", + "uuid": "9f860ab0-175e-4cf6-a457-4e47dc88d73c" + } + ] + }, + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0", + "errors": null, + "id": 16, + "input_connections": { + "results_0|software_cond|input": { + "id": 13, + "output_name": "dedup_pairs_stats" + } + }, + "inputs": [], + "label": "Pairtools MultiQC", + "name": "MultiQC", + "outputs": [ + { + "name": "plots", + "type": "input" + }, + { + "name": "png_plot", + "type": "input" + }, + { + "name": "html_report", + "type": "html" + }, + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 3337.1669910312694, + "top": 301.5986199229453 + }, + "post_job_actions": { + "ChangeDatatypeActionstats": { + "action_arguments": { + "newtype": "tsv" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "stats" + }, + "HideDatasetActionplots": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "plots" + }, + "RenameDatasetActionhtml_report": { + "action_arguments": { + "newname": "Hi-C duplication stats on Curated Assembly: MultiQC" + }, + "action_type": "RenameDatasetAction", + "output_name": "html_report" + }, + "RenameDatasetActionpng_plot": { + "action_arguments": { + "newname": "Pairtools MultiQC on Curated Assembly: Plots" + }, + "action_type": "RenameDatasetAction", + "output_name": "png_plot" + }, + "RenameDatasetActionstats": { + "action_arguments": { + "newname": "Pairtools MultiQC Stats on Curated Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "stats" + }, + "TagDatasetActionhtml_report": { + "action_arguments": { + "tags": "hic_dup_multiqc_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "html_report" + }, + "TagDatasetActionstats": { + "action_arguments": { + "tags": "hic_dup_raw_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "stats" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.33+galaxy0", + "tool_shed_repository": { + "changeset_revision": "26ee5e11ecbe", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": true, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": true, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"pairtools\", \"__current_case__\": 39, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"Hi-C alignements to Scaffold stats\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.33+galaxy0", + "type": "tool", + "uuid": "66905684-e6a1-4d2a-91ad-4809ca5e864a", + "when": null, + "workflow_outputs": [ + { + "label": "Pairtools MultiQC on Curated Assembly: Plots", + "output_name": "png_plot", + "uuid": "b1b67ffc-1027-4ab4-8ccb-6648250469d8" + }, + { + "label": "Hi-C duplication stats on Curated Assembly: MultiQC", + "output_name": "html_report", + "uuid": "bc63d054-d54c-4edc-9486-54328686a2dd" + }, + { + "label": "Pairtools MultiQC Stats on Curated Assembly", + "output_name": "stats", + "uuid": "9d38be8e-bf66-4918-aa21-e9ec59321964" + } + ] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "errors": null, + "id": 17, + "input_connections": { + "bamfile": { + "id": 14, + "output_name": "data_param" + }, + "when": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [], + "label": "Remove duplicates", + "name": "Samtools markdup", + "outputs": [ + { + "name": "output", + "type": "bam" + }, + { + "name": "stats_output", + "type": "txt" + } + ], + "position": { + "left": 2861.3187898750775, + "top": 904.7579298870468 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionstats_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "stats_output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "name:no_duplicates" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "ef678e1f70a2", + "name": "samtools_markdup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": false, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "294a749f-e96a-45d7-9e2b-fd71d0afe5b2", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "errors": null, + "id": 18, + "input_connections": { + "bamfile": { + "id": 14, + "output_name": "data_param" + }, + "when": { + "id": 6, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Keep duplicated", + "name": "Samtools markdup", + "outputs": [ + { + "name": "output", + "type": "bam" + }, + { + "name": "stats_output", + "type": "txt" + } + ], + "position": { + "left": 2852.9687490971037, + "top": 1184.7675817632073 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "HideDatasetActionstats_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "stats_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_markdup/samtools_markdup/1.22+galaxy2", + "tool_shed_repository": { + "changeset_revision": "ef678e1f70a2", + "name": "samtools_markdup", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfile\": {\"__class__\": \"ConnectedValue\"}, \"existing_tags\": false, \"include_fails\": false, \"maxlen\": null, \"mode\": \"s\", \"odist\": \"2500\", \"output_options\": {\"stats\": \"yes\", \"output_format\": {\"select_oformat\": \"BAM\", \"__current_case__\": 1}}, \"remove\": true, \"supp\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy2", + "type": "tool", + "uuid": "9172e934-6ce0-4bc6-a526-e3d3fe539e58", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 19, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 17, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 18, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3242.918659711446, + "top": 959.7107727965537 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Hi-C alignments on Curated Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "curated_hic_alignments" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "0dc73407-3c85-4837-9efc-7046cbe9625e", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C alignments on Curated Assembly", + "output_name": "data_param", + "uuid": "e3031d04-dad3-4de0-a6f5-32303ed180fb" + } + ] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 20, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 17, + "output_name": "stats_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 18, + "output_name": "stats_output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3242.04780593084, + "top": 1189.1824762726665 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "Hi-C duplication stats on on Curated Assembly" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "hi_dup_stats_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e1be9200-6f90-4b6f-a920-416e730a4721", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C duplication stats on Curated Assembly", + "output_name": "data_param", + "uuid": "0173122b-d613-446c-88b5-b63b053d2e93" + } + ] + } + }, + "tags": [], + "uuid": "6f194a56-a67f-4b0e-b19f-538c9eb518d4" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "1e3fc9c0-027f-4225-a44d-ff4bc49e09be", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C duplication stats on Curated Assembly", + "output_name": "Hi-C duplication stats on Curated Assembly", + "uuid": "f68d314f-483d-4ab9-92c2-140209d756b1" + }, + { + "label": "Hi-C duplication stats on Curated Assembly: Raw", + "output_name": "Hi-C duplication stats on Curated Assembly: Raw", + "uuid": "6730fdf8-e9c7-4d87-9e67-aa7213f94168" + }, + { + "label": "Hi-C alignments on Curated Assembly", + "output_name": "Hi-C alignments on Curated Assembly", + "uuid": "11c59f61-6a90-4a86-b177-ebeca7625058" + }, + { + "label": "Pairtools MultiQC Stats on Curated Assembly", + "output_name": "Pairtools MultiQC Stats on Curated Assembly", + "uuid": "5d25f9c5-29d5-4c09-8f8c-d8d5e8490c8e" + }, + { + "label": "Hi-C duplication stats on Curated Assembly: MultiQC", + "output_name": "Hi-C duplication stats on Curated Assembly: MultiQC", + "uuid": "f368f172-2ce4-48f8-90f8-598f36f9d929" + }, + { + "label": "Pairtools MultiQC on Curated Assembly: Plots", + "output_name": "Pairtools MultiQC on Curated Assembly: Plots", + "uuid": "82f7e452-e9aa-4a2b-8a57-b8efe25ae400" + }, + { + "label": "Merged Hi-C Alignments on Curated Assembly", + "output_name": "Merged Hi-C Alignments on Curated Assembly", + "uuid": "debd9187-ec5a-40c0-b6f3-df3eedb3e6ba" + } + ] + }, + "15": { + "annotation": "", + "id": 15, + "input_connections": { + "0:Input dataset collection": { + "id": 7, + "input_subworkflow_step_id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Test if collection has only one item or is empty", + "outputs": [], + "position": { + "left": 1821.0694803285596, + "top": 2240.200932961109 + }, + "subworkflow": { + "a_galaxy_workflow": "true", + "annotation": "", + "comments": [], + "format-version": "0.1", + "name": "Test if collection has only one item or is empty", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 122.83984375 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null, \"collection_type\": \"list:paired\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "9fe6d891-f469-49a0-91a2-6b04be56cdb3", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "errors": null, + "id": 1, + "input_connections": { + "input_collection": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Extract element identifiers", + "outputs": [ + { + "name": "output", + "type": "txt" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2", + "tool_shed_repository": { + "changeset_revision": "d3c07d270a50", + "name": "collection_element_identifiers", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_collection\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.2", + "type": "tool", + "uuid": "50f53cad-f20d-4497-bcfd-98085c5a86ee", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "", + "content_id": "wc_gnu", + "errors": null, + "id": 2, + "input_connections": { + "input1": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Line/Word/Character count", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 586.63671875, + "top": 103.203125 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "wc_gnu", + "tool_state": "{\"include_header\": true, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"options\": [\"lines\", \"words\", \"characters\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "32953718-78f4-4c9d-970a-d5a8f2b5fb90", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 3, + "input_connections": { + "input": { + "id": 2, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 880, + "top": 70 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "762aab88-526b-4989-a674-7b82ae4a0635", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 4, + "input_connections": { + "input1": { + "id": 3, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 1130, + "top": 180 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d6a58216-6cdb-4f7c-92c1-c2d2bc2c0ce6", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 5, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 200 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c7e0fcf7-4af5-48c2-8775-efd5b57c2a40", + "when": null, + "workflow_outputs": [ + { + "label": "Is empty", + "output_name": "output_param_boolean", + "uuid": "93876b5b-60f2-412a-801b-508958d36b8d" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 6, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 440 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"1\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "743b0ec5-0cbb-4eaf-84be-8737ab930d88", + "when": null, + "workflow_outputs": [ + { + "label": "Has a single sample", + "output_name": "output_param_boolean", + "uuid": "c406b112-c81c-465a-9b99-dbcf2cf6ad42" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 7, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "text_param" + } + }, + "inputs": [], + "label": null, + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1410, + "top": 680 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"0\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": \"1\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "31591ac8-3633-45e0-9fab-9af5015221de", + "when": null, + "workflow_outputs": [ + { + "label": "Has multiple samples", + "output_name": "output_param_boolean", + "uuid": "86fae93e-1d80-40a5-9577-1efd63f41241" + } + ] + } + }, + "tags": [], + "uuid": "f3cd0c6f-9666-4d4c-b6b0-d7e107fba5b0" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "c96d9580-43de-4a1a-a59a-3d46b80511c3", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2", + "errors": null, + "id": 16, + "input_connections": { + "fastq_input|fastq_input1": { + "id": 7, + "output_name": "output" + }, + "reference_source|ref_file": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Map with minimap2", + "outputs": [ + { + "name": "alignment_output", + "type": "bam" + } + ], + "position": { + "left": 2235.680136974393, + "top": 2559.438004636745 + }, + "post_job_actions": { + "HideDatasetActionalignment_output": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "alignment_output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/minimap2/minimap2/2.28+galaxy2", + "tool_shed_repository": { + "changeset_revision": "539de907fd99", + "name": "minimap2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"alignment_options\": {\"splicing\": {\"splice_mode\": \"preset\", \"__current_case__\": 0}, \"A\": null, \"B\": null, \"O\": null, \"O2\": null, \"E\": null, \"E2\": null, \"z\": null, \"z2\": null, \"s\": null, \"no_end_flt\": true}, \"fastq_input\": {\"fastq_input_selector\": \"single\", \"__current_case__\": 0, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"analysis_type_selector\": \"map-hifi\"}, \"indexing_options\": {\"H\": false, \"k\": null, \"w\": null, \"I\": null}, \"io_options\": {\"output_format\": \"BAM\", \"Q\": false, \"L\": false, \"K\": null, \"cs\": null, \"c\": false, \"eqx\": false, \"Y\": false}, \"mapping_options\": {\"N\": null, \"F\": null, \"f\": null, \"kmer_ocurrence_interval\": {\"interval\": \"\", \"__current_case__\": 1}, \"min_occ_floor\": null, \"q_occ_frac\": \"0.01\", \"g\": null, \"r\": null, \"n\": null, \"m\": null, \"max_chain_skip\": null, \"max_chain_iter\": null, \"X\": false, \"p\": null, \"mask_len\": null}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.28+galaxy2", + "type": "tool", + "uuid": "9c9cf464-20c0-457f-9c37-8a7018546bd1", + "when": null, + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "errors": null, + "id": 17, + "input_connections": { + "canonical": { + "id": 8, + "output_name": "output" + }, + "input_sequence": { + "id": 1, + "output_name": "output" + }, + "patterns": { + "id": 9, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Teloscope", + "outputs": [ + { + "name": "terminal_telomeres", + "type": "bed" + }, + { + "name": "telo_report", + "type": "tabular" + } + ], + "position": { + "left": 2461.6835427414335, + "top": 1451.8267720836484 + }, + "post_job_actions": { + "RenameDatasetActiontelo_report": { + "action_arguments": { + "newname": "${Haplotype} Telomere Report" + }, + "action_type": "RenameDatasetAction", + "output_name": "telo_report" + }, + "RenameDatasetActionterminal_telomeres": { + "action_arguments": { + "newname": "${Haplotype} terminal telomeres" + }, + "action_type": "RenameDatasetAction", + "output_name": "terminal_telomeres" + }, + "TagDatasetActiontelo_report": { + "action_arguments": { + "tags": "telomere_report" + }, + "action_type": "TagDatasetAction", + "output_name": "telo_report" + }, + "TagDatasetActionterminal_telomeres": { + "action_arguments": { + "tags": "terminal_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "terminal_telomeres" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/teloscope/teloscope/0.1.3+galaxy1", + "tool_shed_repository": { + "changeset_revision": "321ceb58023e", + "name": "teloscope", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"canonical\": {\"__class__\": \"ConnectedValue\"}, \"edit_distance\": \"0\", \"input_sequence\": {\"__class__\": \"ConnectedValue\"}, \"max_block_distance\": \"200\", \"max_match_distance\": \"50\", \"min_block_density\": \"0.5\", \"min_block_length\": \"500\", \"out_entropy\": false, \"out_gc\": false, \"out_its\": false, \"out_matches\": false, \"out_win_repeats\": false, \"patterns\": {\"__class__\": \"ConnectedValue\"}, \"step\": \"500\", \"terminal_limit\": \"50000\", \"ultra_fast\": true, \"verbose\": false, \"window\": \"1000\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.3+galaxy1", + "type": "tool", + "uuid": "51ef86cd-c51f-4573-a799-e9bf46af370e", + "when": null, + "workflow_outputs": [ + { + "label": "terminal telomeres", + "output_name": "terminal_telomeres", + "uuid": "edf9292a-fd55-4391-80ca-d8e0eef89960" + }, + { + "label": "Telomere Report", + "output_name": "telo_report", + "uuid": "83cf865b-a124-4a84-9cf7-8bb6d966ad7c" + } + ] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "errors": null, + "id": 18, + "input_connections": { + "input": { + "id": 12, + "output_name": "stats" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2470.2346886538007, + "top": 819.9547819589295 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "${Haplotype} Gaps BEDgraph" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "Gaps" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "tool_shed_repository": { + "changeset_revision": "aff5135563c6", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"abs(int(c3)-int(c2))\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.1", + "type": "tool", + "uuid": "659f271c-28fd-4b7d-807a-06c7189b159d", + "when": null, + "workflow_outputs": [ + { + "label": "Gaps BEDgraph", + "output_name": "out_file1", + "uuid": "9fa64361-b645-4ca3-91cd-4a0d13f13a41" + } + ] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "errors": null, + "id": 19, + "input_connections": { + "highRes": { + "id": 11, + "output_name": "output" + }, + "input": { + "id": 14, + "output_name": "Hi-C alignments on Curated Assembly" + } + }, + "inputs": [], + "label": "PretextMap - Multimapping", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4590.5690510539025, + "top": 260.3319062633357 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + }, + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "056f86469460", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.3+galaxy0", + "type": "tool", + "uuid": "b7934163-451f-4cab-9f11-2b88bc88f535", + "when": null, + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "input": { + "id": 14, + "output_name": "Hi-C alignments on Curated Assembly" + }, + "when": { + "id": 11, + "output_name": "output" + } + }, + "inputs": [], + "label": "PretextMap - Multimapping for snapshot if high res", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4594.644731598934, + "top": 647.6895092708705 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "056f86469460", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": \"0\", \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.3+galaxy0", + "type": "tool", + "uuid": "ba2e3acb-c0d9-4cd8-99a5-7f4a8a790336", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "errors": null, + "id": 21, + "input_connections": { + "highRes": { + "id": 11, + "output_name": "output" + }, + "input": { + "id": 14, + "output_name": "Hi-C alignments on Curated Assembly" + }, + "map_qual": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4539.320684140101, + "top": 1068.4493796772103 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + }, + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "056f86469460", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": {\"__class__\": \"ConnectedValue\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.3+galaxy0", + "type": "tool", + "uuid": "2bc11d1e-ba89-4a9c-80c9-2b83aa638457", + "when": null, + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "errors": null, + "id": 22, + "input_connections": { + "input": { + "id": 14, + "output_name": "Hi-C alignments on Curated Assembly" + }, + "map_qual": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [], + "label": "PretextMap for snapshot if High res", + "name": "PretextMap", + "outputs": [ + { + "name": "pretext_map_out", + "type": "pretext" + } + ], + "position": { + "left": 4562.93925347705, + "top": 1623.1092249969438 + }, + "post_job_actions": { + "HideDatasetActionpretext_map_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_map_out" + }, + "TagDatasetActionpretext_map_out": { + "action_arguments": { + "tags": "haps_pretext" + }, + "action_type": "TagDatasetAction", + "output_name": "pretext_map_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_map/pretext_map/0.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "056f86469460", + "name": "pretext_map", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"filter\": {\"filter_type\": \"\", \"__current_case__\": 0}, \"highRes\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"map_qual\": {\"__class__\": \"ConnectedValue\"}, \"sorting\": {\"sortby\": \"length\", \"__current_case__\": 1, \"sortorder\": \"descend\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.3+galaxy0", + "type": "tool", + "uuid": "88063aa8-5abd-4d00-a400-713276d6aa37", + "when": null, + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "errors": null, + "id": 23, + "input_connections": { + "bamfiles": { + "id": 16, + "output_name": "alignment_output" + }, + "when": { + "id": 15, + "output_name": "Has multiple samples" + } + }, + "inputs": [], + "label": null, + "name": "Samtools merge", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 2485.364013425041, + "top": 2443.92687885208 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_merge/samtools_merge/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "c8bc9d08b0e3", + "name": "samtools_merge", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"bamfiles\": {\"__class__\": \"ConnectedValue\"}, \"bed_file\": {\"__class__\": \"RuntimeValue\"}, \"headerbam\": {\"__class__\": \"RuntimeValue\"}, \"idpg\": false, \"idrg\": false, \"region\": null, \"seed\": \"1\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "48c3b202-85ca-447b-8f91-fbc440e33366", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "24": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 24, + "input_connections": { + "input": { + "id": 16, + "output_name": "alignment_output" + }, + "when": { + "id": 15, + "output_name": "Has a single sample" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 2485.165845830197, + "top": 2752.7109014217717 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "72de31ed-6ef4-4f67-9150-459573b7e7e5", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 25, + "input_connections": { + "input": { + "id": 17, + "output_name": "terminal_telomeres" + } + }, + "inputs": [], + "label": "Select Q telomeres", + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2714.4971761332267, + "top": 1336.8033860991509 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:q" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c5=='q'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "53ab0338-b786-4af7-b842-fcbf276181e9", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 26, + "input_connections": { + "input": { + "id": 17, + "output_name": "terminal_telomeres" + } + }, + "inputs": [], + "label": "Select P telomeres", + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2711.9856839761055, + "top": 1689.7445778762724 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "name:p" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"cond\": \"c5=='p'\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "fad7b2b6-e2b2-4d73-bb6b-4f57a43d1139", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 27, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 13, + "output_name": "Genes track" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 18, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2941.718456268684, + "top": 354.18401973486885 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "b7fc2c41-f13a-4f26-b5e9-b42420e6265c", + "when": null, + "workflow_outputs": [] + }, + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 28, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 20, + "output_name": "pretext_map_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 19, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Pretext Map for Snapshot", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5174.629561215213, + "top": 719.5042763958141 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e0bcecd0-34a9-4991-b90c-7fca70edba91", + "when": null, + "workflow_outputs": [] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 29, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 22, + "output_name": "pretext_map_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 21, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Pretext Map for Snapshot 2", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5148.343164860567, + "top": 1690.4622107945054 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "33ed6bb4-16d1-4bba-b5cb-64c61a39df91", + "when": null, + "workflow_outputs": [] + }, + "30": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 30, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 23, + "output_name": "output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 24, + "output_name": "output" + } + }, + "inputs": [], + "label": "Hifi Alignments", + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2757.343972549042, + "top": 2618.950853641779 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "${Haplotype} Merged HiFi Alignments" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "merge_hifi_align_curated" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2afb1f1a-4687-4c63-9496-d66c63c23a01", + "when": null, + "workflow_outputs": [ + { + "label": "Merged HiFi Alignments", + "output_name": "data_param", + "uuid": "b0149c13-2ddf-4fb1-9939-5d38c8a98312" + } + ] + }, + "31": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 31, + "input_connections": { + "input": { + "id": 25, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Q telomere BED", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2970.821115983621, + "top": 1389.389394153961 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "${Haplotype} Q telomeres BED" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "q_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "d443834e-e460-4410-ba40-345ba9a25851", + "when": null, + "workflow_outputs": [ + { + "label": "Q telomeres BED", + "output_name": "out_file1", + "uuid": "b9b7d743-5f41-49f3-a640-5a68ee3a63a4" + } + ] + }, + "32": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 32, + "input_connections": { + "input": { + "id": 26, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "P telomere BED", + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 2973.6398415695585, + "top": 1613.195546497711 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "${Haplotype} P telomeres BED" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "p_telomeres" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"columnList\": \"c1,c2,c3,c4\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "49497ce7-bb24-4891-b36a-234feb07f389", + "when": null, + "workflow_outputs": [ + { + "label": "P telomeres BED", + "output_name": "out_file1", + "uuid": "4b23fce7-a313-42ef-b365-783ee0bd24e6" + } + ] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "errors": null, + "id": 33, + "input_connections": { + "input": { + "id": 28, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 6685.6783533422185, + "top": 630.7324027014515 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "tool_shed_repository": { + "changeset_revision": "ff02cf8f66f0", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.5+galaxy1", + "type": "tool", + "uuid": "f453794e-4045-4602-9f49-26abf7f1426f", + "when": null, + "workflow_outputs": [] + }, + "34": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "errors": null, + "id": 34, + "input_connections": { + "input": { + "id": 29, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pretext Snapshot", + "outputs": [ + { + "name": "pretext_snap_out", + "type": "input" + } + ], + "position": { + "left": 6532.174037677532, + "top": 1716.6436808211497 + }, + "post_job_actions": { + "HideDatasetActionpretext_snap_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "pretext_snap_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_snapshot/pretext_snapshot/0.0.5+galaxy1", + "tool_shed_repository": { + "changeset_revision": "ff02cf8f66f0", + "name": "pretext_snapshot", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"colormap\": \"8\", \"formats\": {\"outformat\": \"png\", \"__current_case__\": 0}, \"grid\": {\"showGrid\": \"yes\", \"__current_case__\": 0, \"gridsize\": \"1\", \"gridcolor\": \"black\"}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mintexels\": \"64\", \"resolution\": \"2000\", \"sequencenames\": false, \"sequences\": \"=full\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.5+galaxy1", + "type": "tool", + "uuid": "533b33d8-3a3b-480a-9978-1526d65606c5", + "when": null, + "workflow_outputs": [] + }, + "35": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", + "errors": null, + "id": 35, + "input_connections": { + "bamInput": { + "id": 30, + "output_name": "data_param" + }, + "binSize": { + "id": 10, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "bamCoverage", + "outputs": [ + { + "name": "outFileName", + "type": "bigwig" + } + ], + "position": { + "left": 3016.623882825025, + "top": 2500.1566619198493 + }, + "post_job_actions": { + "RenameDatasetActionoutFileName": { + "action_arguments": { + "newname": "${Haplotype} BigWig Coverage" + }, + "action_type": "RenameDatasetAction", + "output_name": "outFileName" + }, + "TagDatasetActionoutFileName": { + "action_arguments": { + "tags": "coverage" + }, + "action_type": "TagDatasetAction", + "output_name": "outFileName" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/deeptools_bam_coverage/deeptools_bam_coverage/3.5.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "0e49b109abc2", + "name": "deeptools_bam_coverage", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advancedOpt\": {\"showAdvancedOpt\": \"no\", \"__current_case__\": 0}, \"bamInput\": {\"__class__\": \"ConnectedValue\"}, \"binSize\": {\"__class__\": \"ConnectedValue\"}, \"exactScaling\": false, \"outFileFormat\": \"bigwig\", \"region\": \"\", \"scaling\": {\"type\": \"no\", \"__current_case__\": 3}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.5.4+galaxy0", + "type": "tool", + "uuid": "43e863a6-80b4-4c02-a249-ca7a6469ac01", + "when": null, + "workflow_outputs": [ + { + "label": "BigWig Coverage", + "output_name": "outFileName", + "uuid": "99e50ff7-22ae-4afc-af83-e81b69c73931" + } + ] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", + "errors": null, + "id": 36, + "input_connections": { + "input_bams": { + "id": 30, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Samtools depth", + "outputs": [ + { + "name": "output", + "type": "tabular" + } + ], + "position": { + "left": 3018.599013311725, + "top": 2773.899559556594 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_depth/samtools_depth/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "fb6d5ffc365f", + "name": "samtools_depth", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__input_ext\": \"input\", \"additional_options\": {\"required_flags\": null, \"skipped_flags\": [\"4\", \"256\", \"512\", \"1024\"], \"deletions\": false, \"single_read\": false}, \"all\": \"-a\", \"basequality\": null, \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"mapquality\": null, \"maxdepth\": null, \"minlength\": null, \"output_options\": {\"header\": false}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "75e128e1-596f-4804-9d3d-2788ee7bf5b3", + "when": null, + "workflow_outputs": [] + }, + "37": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 37, + "input_connections": { + "input1": { + "id": 31, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Test if Q telomere track is empty", + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 3232.9042274387793, + "top": 1336.2468886682436 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "5a566197-db33-422e-8629-116adda07abc", + "when": null, + "workflow_outputs": [] + }, + "38": { + "annotation": "", + "content_id": "param_value_from_file", + "errors": null, + "id": 38, + "input_connections": { + "input1": { + "id": 32, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": "Test if P telomere track is empty", + "name": "Parse parameter value", + "outputs": [ + { + "name": "text_param", + "type": "expression.json" + } + ], + "position": { + "left": 3248.092100481099, + "top": 1707.4082913428974 + }, + "post_job_actions": { + "HideDatasetActiontext_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "text_param" + } + }, + "tool_id": "param_value_from_file", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"param_type\": \"text\", \"remove_newlines\": true, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.1.0", + "type": "tool", + "uuid": "abb3fd29-c4ee-44e6-82ec-7e3d928501e8", + "when": null, + "workflow_outputs": [] + }, + "39": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 39, + "input_connections": { + "input": { + "id": 33, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 7085.848256831036, + "top": 687.0538296553776 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "png" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "${Haplotype} Pretext Snapshot - Multimapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_img_multimapping" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "7815d57b-da36-42a2-b25c-4cf3dbf89c69", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Snapshot - Multimapping", + "output_name": "output", + "uuid": "e6ff4346-6a00-4142-9d43-384b46a44975" + } + ] + }, + "40": { + "annotation": "", + "content_id": "__EXTRACT_DATASET__", + "errors": null, + "id": 40, + "input_connections": { + "input": { + "id": 34, + "output_name": "pretext_snap_out" + } + }, + "inputs": [], + "label": null, + "name": "Extract dataset", + "outputs": [ + { + "name": "output", + "type": "data" + } + ], + "position": { + "left": 6945.030919069612, + "top": 1655.2532643101972 + }, + "post_job_actions": { + "ChangeDatatypeActionoutput": { + "action_arguments": { + "newtype": "png" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "output" + }, + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "${Haplotype} Pretext Snapshot" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + }, + "TagDatasetActionoutput": { + "action_arguments": { + "tags": "pretext_img_coverage" + }, + "action_type": "TagDatasetAction", + "output_name": "output" + } + }, + "tool_id": "__EXTRACT_DATASET__", + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"which\": {\"which_dataset\": \"first\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "1a9ded49-abf8-425f-b4a2-abcbcb537aa0", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext Snapshot", + "output_name": "output", + "uuid": "8f3a0981-dde7-4e36-aee0-37882dbc6a35" + } + ] + }, + "41": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 41, + "input_connections": { + "input": { + "id": 35, + "output_name": "outFileName" + }, + "pretext": { + "id": 21, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Add Coverage Track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4692.507344884729, + "top": 1401.7505154389646 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "68583f52-0bd8-41b4-8f10-0bd0ed274177", + "when": null, + "workflow_outputs": [] + }, + "42": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 42, + "input_connections": { + "input": { + "id": 35, + "output_name": "outFileName" + }, + "pretext": { + "id": 19, + "output_name": "pretext_map_out" + } + }, + "inputs": [], + "label": "Add Coverage Track - Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4930.873150728038, + "top": 522.7504531561559 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "fd4f30e5-128b-4a4d-b9f6-2239323f99da", + "when": null, + "workflow_outputs": [] + }, + "43": { + "annotation": "", + "content_id": "Filter1", + "errors": null, + "id": 43, + "input_connections": { + "input": { + "id": 36, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Filter", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3237.9830709863745, + "top": 2797.3439573103838 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Filter1", + "tool_state": "{\"__input_ext\": \"tabular\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"cond\": \"c3==0\", \"header_lines\": \"0\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.1", + "type": "tool", + "uuid": "58778da7-33dd-41a1-a2e3-f129e95f3e2e", + "when": null, + "workflow_outputs": [] + }, + "44": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 44, + "input_connections": { + "input_param_type|input_param": { + "id": 37, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "False if Q telomere track is empty", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3533.910131828852, + "top": 1421.1620265654865 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e6ed80e6-3b95-4f21-b6a6-3c6b494d900e", + "when": null, + "workflow_outputs": [] + }, + "45": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 45, + "input_connections": { + "input_param_type|input_param": { + "id": 38, + "output_name": "text_param" + } + }, + "inputs": [], + "label": "False if P telomere track is empty", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3538.369887065075, + "top": 1630.9122923041941 + }, + "post_job_actions": { + "HideDatasetActionoutput_param_boolean": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output_param_boolean" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"\", \"to\": \"false\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"true\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "1659cc59-1a57-4b1f-a6e0-722ac88f1b18", + "when": null, + "workflow_outputs": [] + }, + "46": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "errors": null, + "id": 46, + "input_connections": { + "input": { + "id": 43, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Compute", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3437.9830709863745, + "top": 2517.3439573103838 + }, + "post_job_actions": { + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1", + "tool_shed_repository": { + "changeset_revision": "aff5135563c6", + "name": "column_maker", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"avoid_scientific_notation\": false, \"error_handling\": {\"auto_col_types\": true, \"fail_on_non_existent_columns\": true, \"non_computable\": {\"action\": \"--fail-on-non-computable\", \"__current_case__\": 0}}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"ops\": {\"header_lines_select\": \"no\", \"__current_case__\": 0, \"expressions\": [{\"__index__\": 0, \"cond\": \"c2-1\", \"add_column\": {\"mode\": \"\", \"__current_case__\": 0, \"pos\": \"\"}}]}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.1", + "type": "tool", + "uuid": "28ba3827-13c9-431f-b02c-01904a6f0577", + "when": null, + "workflow_outputs": [] + }, + "47": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 47, + "input_connections": { + "input": { + "id": 32, + "output_name": "out_file1" + }, + "pretext": { + "id": 42, + "output_name": "graph_out" + }, + "when": { + "id": 45, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Add p telomere track Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4933.51724185973, + "top": 159.49598879016884 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"p_telomeres_gap_format\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "57e1a280-5445-4866-9963-fe6a92cc4b56", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "48": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 48, + "input_connections": { + "input": { + "id": 32, + "output_name": "out_file1" + }, + "pretext": { + "id": 41, + "output_name": "graph_out" + }, + "when": { + "id": 45, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Add p telomere track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 4874.351579055826, + "top": 1106.9504024326575 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"p_telomeres_gap_format\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "288ab63e-6d67-4aef-a044-127c2879d5d6", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "49": { + "annotation": "", + "content_id": "Cut1", + "errors": null, + "id": 49, + "input_connections": { + "input": { + "id": 46, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Cut", + "outputs": [ + { + "name": "out_file1", + "type": "tabular" + } + ], + "position": { + "left": 3550.7884845286626, + "top": 2755.836786508236 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "Cut1", + "tool_state": "{\"__input_ext\": \"tabular\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"columnList\": \"c1,c4,c2,c3\", \"delimiter\": \"T\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.2", + "type": "tool", + "uuid": "a216faae-22b0-4592-86ab-a86ebc4b6c4f", + "when": null, + "workflow_outputs": [] + }, + "50": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 50, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 47, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 42, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5252.120524506072, + "top": 549.225398130873 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "09b9cf21-e55a-4847-979d-9b3628fd0945", + "when": null, + "workflow_outputs": [] + }, + "51": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 51, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 48, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 41, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5110.241409174444, + "top": 1294.7032594301413 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "5cd17378-083f-40bb-b4d7-90e7acd1e2a1", + "when": null, + "workflow_outputs": [] + }, + "52": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1+galaxy2", + "errors": null, + "id": 52, + "input_connections": { + "input": { + "id": 49, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "bedtools MergeBED", + "outputs": [ + { + "name": "output", + "type": "bed" + } + ], + "position": { + "left": 3747.9830709863745, + "top": 2497.3439573103838 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_mergebed/2.31.1+galaxy2", + "tool_shed_repository": { + "changeset_revision": "2892111d91f8", + "name": "bedtools", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__input_ext\": \"input\", \"c_and_o_argument_repeat\": [], \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"distance\": \"0\", \"header\": false, \"input\": {\"__class__\": \"ConnectedValue\"}, \"strand\": \"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.31.1+galaxy2", + "type": "tool", + "uuid": "b5d7304d-f565-4fb3-b5be-4dac146f1048", + "when": null, + "workflow_outputs": [ + { + "label": "Coverage gap BED for JBrowse2", + "output_name": "output", + "uuid": "fcc571fa-7293-4ad8-8d45-fe587d6a4033" + } + ] + }, + "53": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 53, + "input_connections": { + "input": { + "id": 31, + "output_name": "out_file1" + }, + "pretext": { + "id": 50, + "output_name": "data_param" + }, + "when": { + "id": 44, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Add q telomere track Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 5370.015339788395, + "top": 190.4950174550865 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"q_telomeres_gap_format\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "a9aac982-2e34-432f-9a3a-a4a7e131021e", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "54": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 54, + "input_connections": { + "input": { + "id": 31, + "output_name": "out_file1" + }, + "pretext": { + "id": 51, + "output_name": "data_param" + }, + "when": { + "id": 44, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Add q telomere track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 5443.457771166481, + "top": 1258.386593440754 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"q_telomeres_gap_format\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "5fdfacdd-5f78-4410-817e-217a31ca9744", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "55": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "errors": null, + "id": 55, + "input_connections": { + "input": { + "id": 52, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Add column", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 3884.915154443368, + "top": 2736.390580341113 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "bedgraph" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "${Haplotype} Coverage Gaps Track" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + }, + "TagDatasetActionout_file1": { + "action_arguments": { + "tags": "coverage_gaps" + }, + "action_type": "TagDatasetAction", + "output_name": "out_file1" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1", + "tool_shed_repository": { + "changeset_revision": "023f0a3760b3", + "name": "add_value", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__input_ext\": \"input\", \"chromInfo\": \"/cvmfs/data.galaxyproject.org/managed/len/ucsc/?.len\", \"exp\": \"200\", \"input\": {\"__class__\": \"ConnectedValue\"}, \"iterate\": \"no\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.1", + "type": "tool", + "uuid": "3db60934-ad45-4089-bfc2-d4805cfa2bc5", + "when": null, + "workflow_outputs": [ + { + "label": "Coverage Gaps Track", + "output_name": "out_file1", + "uuid": "cf85bc54-e8bc-4bca-9a2b-8a068c6f2145" + } + ] + }, + "56": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 56, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 53, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 50, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5610.682959586507, + "top": 561.0043753333345 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "53cee6ad-229f-44a6-8e5b-a5228f6f5d92", + "when": null, + "workflow_outputs": [] + }, + "57": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 57, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 54, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 51, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 5500.076504259661, + "top": 1642.3338172460126 + }, + "post_job_actions": { + "HideDatasetActiondata_param": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "81e184d9-ba58-4fae-87fb-11c4fa6eced3", + "when": null, + "workflow_outputs": [] + }, + "58": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 58, + "input_connections": { + "input": { + "id": 18, + "output_name": "out_file1" + }, + "pretext": { + "id": 56, + "output_name": "data_param" + } + }, + "inputs": [], + "label": "Add gaps track - Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 5845.822027381051, + "top": 342.5136042491993 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "d1ff78bd-39bb-49b6-956f-873f02e58e3d", + "when": null, + "workflow_outputs": [] + }, + "59": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 59, + "input_connections": { + "input": { + "id": 18, + "output_name": "out_file1" + }, + "pretext": { + "id": 57, + "output_name": "data_param" + } + }, + "inputs": [], + "label": "Add gaps track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 5792.819827825169, + "top": 1450.0886244258331 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": null, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "cdf721aa-3c39-4d9d-8bd6-704f391a0cca", + "when": null, + "workflow_outputs": [] + }, + "60": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 60, + "input_connections": { + "input": { + "id": 55, + "output_name": "out_file1" + }, + "pretext": { + "id": 58, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": "Add coverage gaps track - Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 6135.125914098252, + "top": 636.2050530086793 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage_gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "cc0f0fe6-c04c-4e43-b631-cf9afefc2637", + "when": null, + "workflow_outputs": [] + }, + "61": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 61, + "input_connections": { + "input": { + "id": 55, + "output_name": "out_file1" + }, + "pretext": { + "id": 59, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": "Add coverage gaps track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 6109.043832195717, + "top": 1599.1026528213733 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"coverage_gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "a942c184-269c-47f5-8bb3-3643d26c1783", + "when": null, + "workflow_outputs": [] + }, + "62": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 62, + "input_connections": { + "input": { + "id": 27, + "output_name": "data_param" + }, + "pretext": { + "id": 60, + "output_name": "graph_out" + }, + "when": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": "Add gene track - Multimapping", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 6443.940619831165, + "top": 195.40177372991369 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"genes_as_gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "50f15ef0-88bf-4c6e-b694-c5a18f884edc", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "63": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "errors": null, + "id": 63, + "input_connections": { + "input": { + "id": 27, + "output_name": "data_param" + }, + "pretext": { + "id": 61, + "output_name": "graph_out" + }, + "when": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": "Add genes track", + "name": "Pretextgraph", + "outputs": [ + { + "name": "graph_out", + "type": "pretext" + } + ], + "position": { + "left": 6389.009033248582, + "top": 1135.9412046475013 + }, + "post_job_actions": { + "HideDatasetActiongraph_out": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "graph_out" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pretext_graph/pretext_graph/0.0.9+galaxy0", + "tool_shed_repository": { + "changeset_revision": "8e422c873d02", + "name": "pretext_graph", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"name\": \"genes_as_gaps\", \"pretext\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.0.9+galaxy0", + "type": "tool", + "uuid": "f99384e5-6b53-433c-b05c-d043c059707e", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "64": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 64, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 62, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 60, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 6868.554855871704, + "top": 245.5774372975351 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "${Haplotype} Pretext All tracks - Multimapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "pretext_all_tracks_multimapping" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "8f236853-0025-4f21-98ba-fc31812fcef7", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext All tracks - Multimapping", + "output_name": "data_param", + "uuid": "bac19013-cc4e-4587-ae55-aee6d42559fa" + } + ] + }, + "65": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 65, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 63, + "output_name": "graph_out" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 61, + "output_name": "graph_out" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 6912.386698431452, + "top": 1204.9547023974224 + }, + "post_job_actions": { + "RenameDatasetActiondata_param": { + "action_arguments": { + "newname": "${Haplotype} Pretext All tracks" + }, + "action_type": "RenameDatasetAction", + "output_name": "data_param" + }, + "TagDatasetActiondata_param": { + "action_arguments": { + "tags": "pretext_all_tracks" + }, + "action_type": "TagDatasetAction", + "output_name": "data_param" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "998eaa78-1fb7-4f94-a8fc-f666e7e305ba", + "when": null, + "workflow_outputs": [ + { + "label": "Pretext All tracks", + "output_name": "data_param", + "uuid": "bf621bf4-69d2-4bad-895a-526c53b97736" + } + ] + } + }, + "tags": [], + "uuid": "096151ea-e4c9-472e-870c-34c3fc41199b" + }, + "tool_id": null, + "type": "subworkflow", + "uuid": "bcc54ccc-8f17-47f2-88ef-1196f5802aef", + "when": null, + "workflow_outputs": [ + { + "label": "Hap2 Pairtools MultiQC on Curated Assembly: Plots", + "output_name": "Pairtools MultiQC on Curated Assembly: Plots", + "uuid": "b0e3ed9c-4ddc-4077-af34-b9e8de48e308" + }, + { + "label": "Hap2 P telomeres BED", + "output_name": "P telomeres BED", + "uuid": "d1fa39a1-0e90-4142-9504-dc74d3f62bd5" + }, + { + "label": "Hap2 miniprot", + "output_name": "miniprot", + "uuid": "c7c49903-3d8a-4344-a9d5-f15e7f91c192" + }, + { + "label": "Hap2 Hi-C duplication stats on Curated Assembly", + "output_name": "Hi-C duplication stats on Curated Assembly", + "uuid": "d501e7fb-c293-4654-aa61-d2c49e0e78da" + }, + { + "label": "Hap2 Pretext All tracks", + "output_name": "Pretext All tracks", + "uuid": "7dc96a82-d01a-4508-af50-248552f69cff" + }, + { + "label": "Hap2 Genes track", + "output_name": "Genes track", + "uuid": "f372bc14-b504-4947-90e0-1ccb79d99bfd" + }, + { + "label": "Hap2 Gaps BED", + "output_name": "Gaps BED", + "uuid": "e156cf7f-4264-4286-b21a-4c53b673ee65" + }, + { + "label": "Hap2 Pretext Snapshot - Multimapping", + "output_name": "Pretext Snapshot - Multimapping", + "uuid": "262d7f97-0f2e-42da-85cd-b50356028bae" + }, + { + "label": "Hap2 Compleasm Summary", + "output_name": "Compleasm Summary", + "uuid": "06f8956d-e9fd-402a-8786-880b914ac901" + }, + { + "label": "Hap2 Q telomeres BED", + "output_name": "Q telomeres BED", + "uuid": "764276a4-e715-418e-8f1b-74cdbeb7d84a" + }, + { + "label": "Hap2 Merged HiFi Alignments", + "output_name": "Merged HiFi Alignments", + "uuid": "bcb7d211-6aa1-4346-8c89-adc98397541c" + }, + { + "label": "Hap2 Gaps BEDgraph", + "output_name": "Gaps BEDgraph", + "uuid": "90f1d679-4fff-44da-a512-e789962c4864" + }, + { + "label": "Hap2 terminal telomeres", + "output_name": "terminal telomeres", + "uuid": "ce0d0ef0-f23a-40cd-8686-6aca17a439cc" + }, + { + "label": "Hap2 Telomere Report", + "output_name": "Telomere Report", + "uuid": "23fe63c4-28b8-4424-a927-117c38462792" + }, + { + "label": "Hap2 Merged Hi-C Alignments on Curated Assembly", + "output_name": "Merged Hi-C Alignments on Curated Assembly", + "uuid": "099e3c05-dcb4-4d35-a4fe-02aa671ebb41" + }, + { + "label": "Hap2 Hi-C duplication stats on Curated Assembly: MultiQC", + "output_name": "Hi-C duplication stats on Curated Assembly: MultiQC", + "uuid": "00bde974-f46a-4431-9739-f5f34a6745e1" + }, + { + "label": "Hap2 Pairtools MultiQC Stats on Curated Assembly", + "output_name": "Pairtools MultiQC Stats on Curated Assembly", + "uuid": "76b29187-c285-42a8-997b-ca0f84ca3ea6" + }, + { + "label": "Hap2 Hi-C alignments on Curated Assembly", + "output_name": "Hi-C alignments on Curated Assembly", + "uuid": "f1eda199-3779-4ba6-85ea-5467f990ec62" + }, + { + "label": "Hap2 Hi-C duplication stats on Curated Assembly: Raw", + "output_name": "Hi-C duplication stats on Curated Assembly: Raw", + "uuid": "0b0cbf7f-e1cc-406b-a26e-78fecf266bf2" + }, + { + "label": "Hap2 Coverage gap BED for JBrowse2", + "output_name": "Coverage gap BED for JBrowse2", + "uuid": "72875f49-b041-43a1-b5c0-672da4e051fa" + }, + { + "label": "Hap2 Pretext Snapshot", + "output_name": "Pretext Snapshot", + "uuid": "06603a42-a027-430c-81e2-3c3772d366fe" + }, + { + "label": "Hap2 BigWig Coverage", + "output_name": "BigWig Coverage", + "uuid": "8c188550-5509-402f-87f5-bcb594573cbd" + }, + { + "label": "Hap2 Pretext All tracks - Multimapping", + "output_name": "Pretext All tracks - Multimapping", + "uuid": "89bd5509-c64e-4743-8a9a-d93574f1fb54" + }, + { + "label": "Hap2 Coverage Gaps Track", + "output_name": "Coverage Gaps Track", + "uuid": "df4e7c4d-d26f-422b-8815-aeee1f602c4f" + } + ] + }, + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/imagemagick_image_montage/imagemagick_image_montage/7.1.2-2+galaxy1", + "errors": null, + "id": 28, + "input_connections": { + "input": [ + { + "id": 26, + "output_name": "Pretext Snapshot" + }, + { + "id": 27, + "output_name": "Pretext Snapshot" + } + ] + }, + "inputs": [], + "label": null, + "name": "Image Montage", + "outputs": [ + { + "name": "output", + "type": "png" + } + ], + "position": { + "left": 3017.4248657226562, + "top": 688.637685307304 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Hi-C maps for each haplotype" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/imagemagick_image_montage/imagemagick_image_montage/7.1.2-2+galaxy1", + "tool_shed_repository": { + "changeset_revision": "fc43cdc81408", + "name": "imagemagick_image_montage", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"label_options\": {\"label\": \"true\", \"__current_case__\": 0, \"label_indexes\": false}, \"pointsize\": \"16\", \"resize\": \"60\", \"title\": \"Hi-C maps for each haplotype\", \"width\": \"2\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "7.1.2-2+galaxy1", + "type": "tool", + "uuid": "e1caf28d-6e70-47f5-b09a-4378313259dc", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C maps for each haplotype", + "output_name": "output", + "uuid": "1e7a6178-26f2-4df2-b421-2a41ddc7cc53" + } + ] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/bgruening/imagemagick_image_montage/imagemagick_image_montage/7.1.2-2+galaxy1", + "errors": null, + "id": 29, + "input_connections": { + "input": [ + { + "id": 26, + "output_name": "Pretext Snapshot - Multimapping" + }, + { + "id": 27, + "output_name": "Pretext Snapshot - Multimapping" + } + ] + }, + "inputs": [], + "label": null, + "name": "Image Montage", + "outputs": [ + { + "name": "output", + "type": "png" + } + ], + "position": { + "left": 2957.9563598632812, + "top": 1048.3063864791789 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Hi-C maps for each haplotype - Multimapping" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/bgruening/imagemagick_image_montage/imagemagick_image_montage/7.1.2-2+galaxy1", + "tool_shed_repository": { + "changeset_revision": "fc43cdc81408", + "name": "imagemagick_image_montage", + "owner": "bgruening", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": {\"__class__\": \"ConnectedValue\"}, \"label_options\": {\"label\": \"true\", \"__current_case__\": 0, \"label_indexes\": false}, \"pointsize\": \"16\", \"resize\": \"60\", \"title\": \"Hi-C maps for each haplotype - Multimapping\", \"width\": \"2\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "7.1.2-2+galaxy1", + "type": "tool", + "uuid": "e7db354a-6b2e-466e-9e24-b7bcb4244960", + "when": null, + "workflow_outputs": [ + { + "label": "Hi-C maps for each haplotype - Multimapping", + "output_name": "output", + "uuid": "9f3f9584-2515-4c5a-9419-97496bc4fcff" + } + ] + }, + "30": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "errors": null, + "id": 30, + "input_connections": { + "assemblies_0|reference_genome|genome": { + "id": 20, + "output_name": "Curated Hap1" + }, + "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 23, + "output_name": "mashout" + }, + "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "Gaps BED" + }, + "assemblies_0|track_groups_1|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "Coverage gap BED for JBrowse2" + }, + "assemblies_0|track_groups_1|data_tracks_2|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "terminal telomeres" + }, + "assemblies_0|track_groups_1|data_tracks_3|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "BigWig Coverage" + }, + "assemblies_1|reference_genome|genome": { + "id": 20, + "output_name": "Curated Hap2" + }, + "assemblies_1|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "Gaps BED" + }, + "assemblies_1|track_groups_0|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "Coverage gap BED for JBrowse2" + }, + "assemblies_1|track_groups_0|data_tracks_2|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "terminal telomeres" + }, + "assemblies_1|track_groups_0|data_tracks_3|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "BigWig Coverage" + }, + "when": { + "id": 19, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "JBrowse2", + "outputs": [ + { + "name": "output", + "type": "html" + } + ], + "position": { + "left": 3460.1814575195312, + "top": 654.5562744140625 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "JBrowse2 without Gene tracks" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd903fbbc26e", + "name": "jbrowse2", + "owner": "fubar", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Synteny\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Tracks Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 2, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 3, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 1, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Tracks Hap2\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 2, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 3, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.7.0+galaxy0", + "type": "tool", + "uuid": "eb4cb7cf-0b3e-409c-ac02-42db19007d55", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "JBrowse2 without Gene tracks", + "output_name": "output", + "uuid": "76bc6a0e-36a1-498a-a52f-ab2df6642840" + } + ] + }, + "31": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "errors": null, + "id": 31, + "input_connections": { + "assemblies_0|reference_genome|genome": { + "id": 20, + "output_name": "Curated Hap1" + }, + "assemblies_0|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 23, + "output_name": "mashout" + }, + "assemblies_0|track_groups_1|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "Gaps BED" + }, + "assemblies_0|track_groups_1|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "Coverage gap BED for JBrowse2" + }, + "assemblies_0|track_groups_1|data_tracks_2|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "terminal telomeres" + }, + "assemblies_0|track_groups_1|data_tracks_3|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "BigWig Coverage" + }, + "assemblies_0|track_groups_1|data_tracks_4|data_format|annotation_cond|annotation": { + "id": 26, + "output_name": "miniprot" + }, + "assemblies_1|reference_genome|genome": { + "id": 20, + "output_name": "Curated Hap2" + }, + "assemblies_1|track_groups_0|data_tracks_0|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "Gaps BED" + }, + "assemblies_1|track_groups_0|data_tracks_1|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "Coverage gap BED for JBrowse2" + }, + "assemblies_1|track_groups_0|data_tracks_2|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "terminal telomeres" + }, + "assemblies_1|track_groups_0|data_tracks_3|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "BigWig Coverage" + }, + "assemblies_1|track_groups_0|data_tracks_4|data_format|annotation_cond|annotation": { + "id": 27, + "output_name": "miniprot" + }, + "when": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "JBrowse2", + "outputs": [ + { + "name": "output", + "type": "html" + } + ], + "position": { + "left": 3926.853097312235, + "top": 177.36181960347474 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "JBrowse2 with Gene tracks" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_id": "toolshed.g2.bx.psu.edu/repos/fubar/jbrowse2/jbrowse2/3.7.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bd903fbbc26e", + "name": "jbrowse2", + "owner": "fubar", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"action\": {\"action_select\": \"create\", \"__current_case__\": 0}, \"assemblies\": [{\"__index__\": 0, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Synteny\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"synteny\", \"__current_case__\": 7, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearSyntenyDisplay\", \"__current_case__\": 1}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}, {\"__index__\": 1, \"category\": \"Tracks Hap1\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 2, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 3, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 4, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}, {\"__index__\": 1, \"reference_genome\": {\"genome_type_select\": \"history\", \"__current_case__\": 1, \"genome\": {\"__class__\": \"ConnectedValue\"}}, \"defaultLocation\": \"\", \"ref_name_aliases\": {\"__class__\": \"RuntimeValue\"}, \"cytobands\": {\"__class__\": \"RuntimeValue\"}, \"track_groups\": [{\"__index__\": 0, \"category\": \"Tracks Hap2\", \"data_tracks\": [{\"__index__\": 0, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 1, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 2, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 3, \"data_format\": {\"data_format_select\": \"wiggle\", \"__current_case__\": 3, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"jbstyle\": {\"track_style\": {\"display\": \"LinearWiggleDisplay\", \"__current_case__\": 0, \"wig_renderer\": \"xyplot\"}}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}, {\"__index__\": 4, \"data_format\": {\"data_format_select\": \"gene_calls\", \"__current_case__\": 0, \"annotation_cond\": {\"annotation_source\": \"history\", \"__current_case__\": 0, \"annotation\": {\"__class__\": \"ConnectedValue\"}}, \"index\": false, \"jbstyle\": {\"track_style\": {\"display\": \"LinearBasicDisplay\", \"__current_case__\": 0, \"display_mode\": \"normal\", \"show_labels\": true, \"labels_name\": \"jexl:get(feature,'name') || get(feature,'id')\", \"show_descriptions\": true, \"descriptions_name\": \"jexl:get(feature,'note') || get(feature,'description')\", \"max_height\": \"600\"}}, \"formatdetails\": {\"formatdetails_feature\": null, \"formatdetails_subfeature\": null, \"formatdetails_depth\": \"1\"}, \"metadata\": {\"galaxy_metadata\": true, \"metadata_bonus\": {\"__class__\": \"RuntimeValue\"}}, \"track_visibility\": \"default_on\"}}]}]}], \"jbgen\": {\"enableAnalytics\": false, \"primary_color\": \"#0d233f\", \"secondary_color\": \"#721e63\", \"tertiary_color\": \"#135560\", \"quaternary_color\": \"#ffb11d\", \"font_size\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.7.0+galaxy0", + "type": "tool", + "uuid": "fdd9191d-4bf0-482e-99f4-907416520a57", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "JBrowse2 with Gene tracks", + "output_name": "output", + "uuid": "36115c1a-67cf-46e1-8306-1c18290bfa1d" + } + ] + } + }, + "tags": [ + "VGP", + "assembly", + "post-curation" + ], + "uuid": "dc0dcb92-5ea2-4bdc-af71-968dc3d1423c", + "version": 4, + "release": "0.1" +} diff --git a/workflows/VGP-assembly-v2/post-curation-processing/README.md b/workflows/VGP-assembly-v2/post-curation-processing/README.md new file mode 100644 index 0000000000..f92525d78b --- /dev/null +++ b/workflows/VGP-assembly-v2/post-curation-processing/README.md @@ -0,0 +1,129 @@ +# Post-curation assembly processing and evaluation + +This workflow performs post-curation processing and evaluation for VGP assemblies. It takes a curated AGP file and combined haplotype FASTA, splits by haplotype, applies curation, assigns chromosome names, renames and reorients hap2 to match hap1, and generates QC outputs including Compleasm results, Pretext maps, telomere analysis, and coverage tracks. + +## Inputs + +### Required Inputs + +1. **Species Name** [text] - Species identifier +2. **Assembly Name** [text] - Assembly identifier +3. **Curated AGP file** [tabular] - Generated by PretextView after manual curation (PretextView AGP v2.1 format with haplotype labels) +4. **Fasta file with both haplotypes** [fasta] - Generated by the pre-curation workflow, containing both haplotypes in a single file +5. **Database for Compleasm Genes** [text] - Compleasm lineage dataset (e.g., vertebrata_odb10, primates_odb10) +6. **Hi-C reads** [list:paired] - Paired collection of Hi-C sequencing data +7. **PacBio reads** [list] - Collection of PacBio HiFi reads + +### Processing Options + +8. **Generate Gene tracks with Compleasm?** [boolean] - Enable/disable Compleasm gene annotation tracks +9. **Trim the Hi-C data?** [boolean] - Trim 5 bases at the beginning of each read. Use with Arima Hi-C data if the Hi-C map looks "noisy" +10. **Remove duplicated Hi-C reads?** [boolean] - Remove PCR duplicates from Hi-C data +11. **Remove adapters from HiFi reads?** [boolean] - Select no if using HiFi reads trimmed in a previous workflow +12. **Generate high resolution Hi-C maps?** [boolean] - Generate high resolution Pretext maps + +### Analysis Parameters + +13. **Canonical telomeric pattern** [text] - Default: TTAGGG (for vertebrate genomes) +14. **Telomere patterns to explore** [text] - Telomere repeat patterns to search for (comma-separated, IUPAC allowed) +15. **Minimum Mapping Quality** [integer] - Minimum mapping score for Hi-C alignments. Default: 10 +16. **Bin Size for BigWig files** [integer] - Bin size for coverage tracks. Default: 100 + +### Haplotype Naming + +17. **Name Haplotype 1** [text] - Label for haplotype 1 (used to prefix output names) +18. **Name Haplotype 2** [text] - Label for haplotype 2 (used to prefix output names) + +## Outputs + +### Assembly Summary + +- **Assembly information** - Assembly summary information + +### Curation Results + +- **Corrected AGP** - AGP file with corrections applied +- **Curated Hap1** - Curated haplotype 1 FASTA +- **Curated Hap2** - Curated haplotype 2 FASTA +- **Hap1 AGP** - Haplotype 1 AGP +- **Hap2 Unlocs no hap dups AGP** - Haplotype 2 AGP without haplotypic duplicates in unlocalized scaffolds +- **Hap1 Unlocs no hap dups AGP** - Haplotype 1 AGP without haplotypic duplicates in unlocalized scaffolds +- **Hap1 Unlocs** - Haplotype 1 unlocalized scaffolds +- **Hap2 Unlocs** - Haplotype 2 unlocalized scaffolds +- **Hap1 Haplotigs** - Haplotype 1 haplotigs +- **Hap2 AGP** - Haplotype 2 AGP (primary AGP for haplotype 2) + +### Chromosome Assignment + +- **Chromosome mapping Hap1** - Scaffold to chromosome mapping for haplotype 1 (SUPER_N naming) +- **Chromosome mapping Hap2** - Scaffold to chromosome mapping for haplotype 2 +- **Chromosome level Hap2** - Chromosome-level haplotype 2 FASTA + +### Rename and Reorient + +- **Mashmap for Hap2 sync** - Mashmap alignment between haplotypes at chromosome level (from curation subworkflow) +- **Mashmap Chromosome level** - Mashmap alignment between curated haplotypes +- **Hap1 Hap2 orientation mapping** - Orientation mapping between haplotypes +- **Reorientation and renaming instructions** - Instructions for renaming and reorienting hap2 +- **Sequences missing in mashmap** - Sequences not aligned by mashmap + +### Visualization + +- **JBrowse2 without Gene tracks** - JBrowse2 visualization without gene annotation tracks +- **JBrowse2 with Gene tracks** - JBrowse2 visualization with Compleasm gene annotation tracks +- **Hi-C maps for each haplotype** - Combined Hi-C contact maps (MAPQ filtered) +- **Hi-C maps for each haplotype - Multimapping** - Combined Hi-C contact maps (multimapping) + +### Haplotype 1 QC + +- **Hap1 Telomere Report** - Telomere analysis report +- **Hap1 terminal telomeres** - Terminal telomere positions +- **Hap1 P telomeres BED** - P-arm telomere positions +- **Hap1 Q telomeres BED** - Q-arm telomere positions +- **Hap1 Gaps BED** - Assembly gaps BED file +- **Hap1 Gaps BEDgraph** - Assembly gaps bedgraph +- **Hap1 Genes track** - Compleasm gene annotation track +- **Hap1 Compleasm Summary** - Compleasm completeness summary +- **Hap1 miniprot** - Miniprot protein-to-genome alignments +- **Hap1 BigWig Coverage** - PacBio read coverage track +- **Hap1 Coverage Gaps Track** - Coverage gaps track +- **Hap1 Coverage gap BED for JBrowse2** - Coverage gaps BED for JBrowse2 +- **Hap1 Merged HiFi Alignments** - Merged PacBio HiFi alignments +- **Hap1 Merged Hi-C Alignments on Curated Assembly** - Merged Hi-C alignments +- **Hap1 Hi-C alignments on Curated Assembly** - Hi-C alignments +- **Hap1 Hi-C duplication stats on Curated Assembly** - Hi-C duplication statistics +- **Hap1 Hi-C duplication stats on Curated Assembly: Raw** - Raw duplication statistics +- **Hap1 Hi-C duplication stats on Curated Assembly: MultiQC** - MultiQC duplication report +- **Hap1 Pairtools MultiQC Stats on Curated Assembly** - Pairtools MultiQC statistics +- **Hap1 Pairtools MultiQC on Curated Assembly: Plots** - Pairtools MultiQC plots +- **Hap1 Pretext All tracks** - Pretext map with all tracks (MAPQ filtered) +- **Hap1 Pretext All tracks - Multimapping** - Pretext map with all tracks (multimapping) +- **Hap1 Pretext Snapshot** - Pretext snapshot for haplotype 1 +- **Hap1 Pretext Snapshot - Multimapping** - Pretext snapshot with tracks (multimapping) + +### Haplotype 2 QC + +- **Hap2 Telomere Report** - Telomere analysis report +- **Hap2 terminal telomeres** - Terminal telomere positions +- **Hap2 P telomeres BED** - P-arm telomere positions +- **Hap2 Q telomeres BED** - Q-arm telomere positions +- **Hap2 Gaps BED** - Assembly gaps BED file +- **Hap2 Gaps BEDgraph** - Assembly gaps bedgraph +- **Hap2 Genes track** - Compleasm gene annotation track +- **Hap2 Compleasm Summary** - Compleasm completeness summary +- **Hap2 miniprot** - Miniprot protein-to-genome alignments +- **Hap2 BigWig Coverage** - PacBio read coverage track +- **Hap2 Coverage Gaps Track** - Coverage gaps track +- **Hap2 Coverage gap BED for JBrowse2** - Coverage gaps BED for JBrowse2 +- **Hap2 Merged HiFi Alignments** - Merged PacBio HiFi alignments +- **Hap2 Merged Hi-C Alignments on Curated Assembly** - Merged Hi-C alignments +- **Hap2 Hi-C alignments on Curated Assembly** - Hi-C alignments +- **Hap2 Hi-C duplication stats on Curated Assembly** - Hi-C duplication statistics +- **Hap2 Hi-C duplication stats on Curated Assembly: Raw** - Raw duplication statistics +- **Hap2 Hi-C duplication stats on Curated Assembly: MultiQC** - MultiQC duplication report +- **Hap2 Pairtools MultiQC Stats on Curated Assembly** - Pairtools MultiQC statistics +- **Hap2 Pairtools MultiQC on Curated Assembly: Plots** - Pairtools MultiQC plots +- **Hap2 Pretext All tracks** - Pretext map with all tracks (MAPQ filtered) +- **Hap2 Pretext All tracks - Multimapping** - Pretext map with all tracks (multimapping) +- **Hap2 Pretext Snapshot** - Pretext snapshot for haplotype 2 +- **Hap2 Pretext Snapshot - Multimapping** - Pretext snapshot with tracks (multimapping)