diff --git a/README.md b/README.md
index fceac68..8bb0d7d 100644
--- a/README.md
+++ b/README.md
@@ -171,18 +171,54 @@ Alias: `strt-seq`
 
 ### QC aggregation
 
-Run from the parent directory containing per-sample output folders:
+```bash
+starsolo qc <dir1> [dir2 … dirN] [options]
+```
+
+Pass one or more STARsolo output directories as positional arguments:
 
 ```bash
-starsolo qc | column -t
+starsolo qc sample1/ sample2/ sample3/
+starsolo qc results/GSM* | column -t
+starsolo qc sample1/ sample2/ --species human
+starsolo qc sample1/ sample2/ --no-contamination-check
 ```
 
-Checks for:
-- Incomplete runs (`_STARtmp` still present)
-- Barcode cross-contamination between samples
-- Low mapping percentages
+#### QC options
+
+| Flag | Description | Default |
+|:--|:--|:--|
+| `-s, --species <name>` | Override species label in output (e.g. `human`, `mouse`) | guessed from `genomeDir` in `Log.out` |
+| `--no-contamination-check` | Skip cross-sample barcode overlap check | off (check runs by default) |
+| `-h, --help` | Show help | — |
 
-Outputs a tab-separated table with read counts, mapping rates, cell counts, and configuration for each sample.
+#### Checks performed
+
+- **Completion** — warns if `_STARtmp` is still present (run did not finish)
+- **Cross-contamination** — compares filtered barcodes between every pair of samples; warns if overlap exceeds 20%
+- **Low mapping** — warns if `GeneFull` unique mapping rate is ≤ 20%
+
+#### Output columns
+
+Outputs a tab-separated table to stdout (pipe through `column -t` for aligned display):
+
+| Column | Description |
+|:--|:--|
+| `Sample` | Directory name |
+| `Rd_all` | Total reads |
+| `Rd_in_cells` | Reads in cells (GeneFull) |
+| `Frc_in_cells` | Fraction of reads in cells |
+| `UMI_in_cells` | UMIs in cells |
+| `Cells` | Estimated number of cells |
+| `Med_nFeature` | Median genes per cell |
+| `Good_BC` | Fraction of reads with valid barcodes |
+| `WL` | Detected whitelist (`v1`, `v2`, `v3`, `v4-3p`, `v4-5p`, `arc`) |
+| `Species` | Species label |
+| `Paired` | `Single` or `Paired` |
+| `Strand` | Strand specificity |
+| `all_u+m` / `all_u` | Genome mapping rate (unique+multi / unique) |
+| `exon_u+m` / `exon_u` | Exonic (Gene) mapping rate |
+| `full_u+m` / `full_u` | Full-gene (GeneFull) mapping rate |
 
 ## Configuration
 
@@ -202,7 +238,7 @@ CLI flags always take precedence over environment variables, which take preceden
 | Script | Purpose |
 |:--|:--|
 | [scripts/bbduk_trim.sh](scripts/bbduk_trim.sh) | Adapter/polyA trimming via BBMap |
-| [scripts/bsub_submit.sh](scripts/bsub_submit.sh) | Submit any starsolo command as an LSF job |
+| [scripts/bsub_submit.sh](scripts/bsub_submit.sh) | Submit any `starsolo` command as an LSF job |
 
 ### LSF submission
 
@@ -238,7 +274,8 @@ STARsolo/
 │   ├── platform_dropseq.sh   # Drop-seq logic
 │   ├── platform_rhapsody.sh  # BD Rhapsody logic
 │   ├── platform_indrops.sh   # inDrops logic
-│   └── platform_strt.sh      # STRT-seq logic
+│   ├── platform_strt.sh      # STRT-seq logic
+│   └── qc.sh                 # QC aggregation logic
 ├── etc/
 │   └── defaults.conf          # Default configuration
 ├── scripts/
diff --git a/bin/starsolo b/bin/starsolo
index 1dc4aa8..1fd6cf0 100755
--- a/bin/starsolo
+++ b/bin/starsolo
@@ -41,6 +41,7 @@ source "$STARSOLO_ROOT/lib/platform_dropseq.sh"
 source "$STARSOLO_ROOT/lib/platform_rhapsody.sh"
 source "$STARSOLO_ROOT/lib/platform_indrops.sh"
 source "$STARSOLO_ROOT/lib/platform_strt.sh"
+source "$STARSOLO_ROOT/lib/qc.sh"
 
 # ---------- Top-level help ---------------------------------------------------
 
@@ -60,7 +61,7 @@ Platforms:
   rhapsody    BD Rhapsody (3 barcode segments, 8 bp UMI)
   indrops     inDrops (2 barcode segments + adapter, 6 bp UMI)
   strt        STRT-seq (96-barcode whitelist, 8 bp CB, 8 bp UMI)
-  qc          Aggregate QC stats across completed runs
+  qc          Aggregate QC stats across completed runs (see: starsolo qc --help)
 
 Global options (available for all platforms):
   -s, --species <name>      Species (e.g. human, mouse); resolves reference
@@ -85,7 +86,7 @@ Examples:
   starsolo rhapsody /data/fastqs SAMPLE1 --species human
   starsolo indrops /data/fastqs SAMPLE1 --species human --adapter GAGTGATTGCTTGTGACGCCAA
   starsolo strt /data/fastqs SAMPLE1 --species human --strand Reverse
-  starsolo qc
+  starsolo qc sample1/ sample2/ --species human
 EOF
 }
 
@@ -193,16 +194,6 @@ parse_droplet_args() {
     BAM=$(resolve_bam_flags "$BAM_MODE")
 }
 
-# ---------- QC subcommand ---------------------------------------------------
-
-run_qc() {
-    local QC_SCRIPT="$STARSOLO_ROOT/scripts/solo_qc.sh"
-    if [[ ! -x "$QC_SCRIPT" ]]; then
-        die "QC script not found: $QC_SCRIPT"
-    fi
-    exec bash "$QC_SCRIPT" "$@"
-}
-
 # ---------- Dispatch --------------------------------------------------------
 
 main() {
@@ -266,6 +257,9 @@ main() {
             run_strt "$FQDIR" "$TAG" "$CPUS" "$REF" "$WL" "$BAM" "$STRAND"
             ;;
         qc)
+            if [[ "${1:-}" == "-h" || "${1:-}" == "--help" ]]; then
+                show_qc_help; exit 0
+            fi
             run_qc "$@"
             ;;
         *)
diff --git a/lib/qc.sh b/lib/qc.sh
new file mode 100644
index 0000000..1b899f0
--- /dev/null
+++ b/lib/qc.sh
@@ -0,0 +1,242 @@
+#!/bin/bash
+# =============================================================================
+# STARsolo CLI - QC aggregation
+# =============================================================================
+# Aggregate QC statistics for one or more STARsolo output directories.
+# =============================================================================
+
+# ---------- Helpers ----------------------------------------------------------
+
+_qc_guess_species() {
+    local logfile="$1"
+    local genomedir
+    genomedir=$(grep "^genomeDir" "$logfile" | tail -n1)
+    if echo "$genomedir" | grep -q "/human/"; then
+        echo "Human"
+    elif echo "$genomedir" | grep -q "/mouse/"; then
+        echo "Mouse"
+    else
+        echo "Other"
+    fi
+}
+
+_qc_guess_wl() {
+    local logfile="$1"
+    local wlfile
+    wlfile=$(grep "^soloCBwhitelist" "$logfile" | tail -n1 | awk '{print $NF}')
+    wlfile=$(basename "$wlfile")
+    case "$wlfile" in
+        3M-february-2018.txt)    echo "v3"    ;;
+        3M-3pgex-may-2023.txt)   echo "v4-3p" ;;
+        3M-5pgex-jan-2023.txt)   echo "v4-5p" ;;
+        737K-august-2016.txt)    echo "v2"    ;;
+        737K-april-2014_rc.txt)  echo "v1"    ;;
+        737K-arc-v1.txt)         echo "arc"   ;;
+        *)                       echo "Undef" ;;
+    esac
+}
+
+# ---------- Main QC workflow -------------------------------------------------
+
+run_qc() {
+    local FORCE_SPECIES="" CHECK_CONTAMINATION=1
+    local -a DIRS=()
+
+    # --- Argument parsing ---
+    while (( $# > 0 )); do
+        case "$1" in
+            -h|--help)
+                show_qc_help; exit 0 ;;
+            -s|--species|--specie)
+                FORCE_SPECIES="$2"; shift 2 ;;
+            --no-contamination-check)
+                CHECK_CONTAMINATION=0; shift ;;
+            -*)
+                die "Unknown option: $1. Run 'starsolo qc --help'." ;;
+            *)
+                DIRS+=("$1"); shift ;;
+        esac
+    done
+
+    if (( ${#DIRS[@]} == 0 )); then
+        show_qc_help
+        exit 0
+    fi
+
+    # Strip trailing slashes
+    local -a CLEAN_DIRS=()
+    local d
+    for d in "${DIRS[@]}"; do
+        CLEAN_DIRS+=("${d%/}")
+    done
+
+    # --- Check completion status ---
+    log_info "Checking that all STARsolo jobs went to completion …"
+    local i
+    for i in "${CLEAN_DIRS[@]}"; do
+        if [[ -d "$i/output" && -s "$i/Log.final.out" ]]; then
+            if [[ -d "$i/_STARtmp" ]]; then
+                log_warn "Sample $i did not run to completion: _STARtmp is still present!"
+            fi
+        fi
+    done
+
+    # --- Cross-contamination check ---
+    if (( CHECK_CONTAMINATION )); then
+        log_info "Checking potential sample cross-contamination …"
+        local TMPDIR_SORT
+        TMPDIR_SORT=$(mktemp -d)
+
+        local j local_i local_j N1 N2 MIN COMM PCT
+        for i in "${CLEAN_DIRS[@]}"; do
+            if [[ -s "$i/output/Gene/filtered/barcodes.tsv.gz" ]]; then
+                for j in "${CLEAN_DIRS[@]}"; do
+                    if [[ -s "$j/output/Gene/filtered/barcodes.tsv.gz" && "$i" != "$j" ]]; then
+                        local_i="$TMPDIR_SORT/$(basename "$i").barcodes.tsv"
+                        local_j="$TMPDIR_SORT/$(basename "$j").barcodes.tsv"
+                        if [[ ! -s "$local_i" ]]; then
+                            zcat "$i/output/Gene/filtered/barcodes.tsv.gz" | sort > "$local_i" &
+                        fi
+                        if [[ ! -s "$local_j" ]]; then
+                            zcat "$j/output/Gene/filtered/barcodes.tsv.gz" | sort > "$local_j" &
+                        fi
+                        wait
+                        N1=$(wc -l < "$local_i")
+                        N2=$(wc -l < "$local_j")
+                        MIN=$(( N1 <= N2 ? N1 : N2 ))
+                        COMM=$(comm -12 "$local_i" "$local_j" | wc -l)
+                        PCT=$(echo "$COMM" | awk -v v="$MIN" '{printf "%d\n",100*$1/v+0.5}')
+                        if (( PCT >= 20 )); then
+                            log_warn "Samples $i ($N1 barcodes) and $j ($N2 barcodes) share $COMM ($PCT%) barcodes — higher than expected!"
+                        fi
+                    fi
+                done
+            elif [[ -d "$i/output" && -s "$i/Log.out" ]]; then
+                log_info "Sample $i: no filtered output detected (probably plate-based)."
+            fi
+        done
+        rm -rf "$TMPDIR_SORT"
+    else
+        log_info "Skipping cross-contamination check (--no-contamination-check)."
+    fi
+
+    # --- Extract and output statistics ---
+    log_info "Extracting STARsolo stats …"
+    >&2 echo
+
+    echo -e "Sample\tRd_all\tRd_in_cells\tFrc_in_cells\tUMI_in_cells\tCells\tMed_nFeature\tGood_BC\tWL\tSpecies\tPaired\tStrand\tall_u+m\tall_u\texon_u+m\texon_u\tfull_u+m\tfull_u"
+
+    local REF WL R1 B G1 G2 E1 E2 F1 F2 C R2 CF R3 GC ST PAIRED F2PCT
+    for i in "${CLEAN_DIRS[@]}"; do
+
+        if [[ -d "$i/output/Gene/filtered/" && -s "$i/Log.out" ]]; then
+            # --- Droplet-based ---
+            PAIRED="Single"
+            if grep -q "clip5pNbases 39 0" "$i/Log.out"; then
+                PAIRED="Paired"
+            fi
+
+            if [[ -n "$FORCE_SPECIES" ]]; then
+                REF="$FORCE_SPECIES"
+            else
+                REF=$(_qc_guess_species "$i/Log.out")
+            fi
+
+            WL=$(_qc_guess_wl "$i/Log.out")
+
+            R1=$(grep "Number of Reads,"                                   "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            B=$( grep "Reads With Valid Barcodes,"                         "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            G1=$(grep "Reads Mapped to Genome: Unique+Multiple,"           "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            G2=$(grep "Reads Mapped to Genome: Unique,"                    "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            E1=$(grep "Reads Mapped to Gene: Unique+Multip.*e Gene,"       "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            E2=$(grep "Reads Mapped to Gene: Unique Gene,"                 "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            F1=$(grep "Reads Mapped to GeneFull: Unique+Multip.*e GeneFull," "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
+            F2=$(grep "Reads Mapped to GeneFull: Unique GeneFull,"         "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
+            C=$( grep "Estimated Number of Cells,"                         "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
+            R2=$(grep "Unique Reads in Cells Mapped to GeneFull,"          "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
+            CF=$(echo "$R1" | awk -v v="$R2" '{printf "%.3f\n",v/$1}')
+            R3=$(grep "UMIs in Cells,"                                     "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
+            GC=$(grep "Median GeneFull per Cell,"                          "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
+            ST=$(grep "^soloStrand" "$i/Log.out" | grep RE-DEFINED | awk '{print $2}')
+
+            if [[ -z "$ST" ]]; then
+                ST="Undef"
+            elif [[ "$PAIRED" == "Paired" ]]; then
+                ST="Reverse"
+            fi
+
+            F2PCT=$(echo "$F2" | awk '{printf "%d\n",$1*100+0.5}')
+            if (( F2PCT <= 20 )); then
+                log_warn "Sample $i: GeneFull percentage ($F2PCT%) is too low!"
+            fi
+
+            echo -e "$i\t$R1\t$R2\t$CF\t$R3\t$C\t$GC\t$B\t$WL\t$REF\t$PAIRED\t$ST\t$G1\t$G2\t$E1\t$E2\t$F1\t$F2"
+
+        elif [[ -d "$i/output" && -s "$i/Log.out" ]]; then
+            # --- Plate-based (Smart-seq2 etc.) ---
+            PAIRED="Single"
+            if grep -q "mate 2" "$i/Log.out"; then
+                PAIRED="Paired"
+            fi
+
+            if [[ -n "$FORCE_SPECIES" ]]; then
+                REF="$FORCE_SPECIES"
+            else
+                REF=$(_qc_guess_species "$i/Log.out")
+            fi
+
+            WL="Undef"
+            if grep -q "manifest" "$i/Log.out"; then
+                WL="None(Smart-seq)"
+            fi
+
+            R1=$(grep "Number of Reads,"                                   "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            B=$( grep "Reads With Valid Barcodes,"                         "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            G1=$(grep "Reads Mapped to Genome: Unique+Multiple,"           "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            G2=$(grep "Reads Mapped to Genome: Unique,"                    "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            E1=$(grep "Reads Mapped to Gene: Unique+Multip.*e Gene,"       "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            E2=$(grep "Reads Mapped to Gene: Unique Gene,"                 "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
+            F1=$(grep "Reads Mapped to GeneFull: Unique+Multip.*e GeneFull," "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
+            F2=$(grep "Reads Mapped to GeneFull: Unique GeneFull,"         "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
+            C=$( zcat "$i/output/Gene/raw/barcodes.tsv.gz" | wc -l)
+            R2=$(grep "yessubWLmatch_UniqueFeature" "$i/output/GeneFull/Features.stats" | awk '{print $2}')
+            CF=$(echo "$R1" | awk -v v="$R2" '{printf "%.3f\n",v/$1}')
+            R3=$(grep "yesUMIs" "$i/output/GeneFull/Features.stats" | awk '{print $2}')
+            GC=$(zcat "$i/output/GeneFull/raw/matrix.mtx.gz" | awk 'NR>3 {print $2}' | uniq -c | awk '{print $1}' | sort -n | awk '{a[i++]=$1} END {print a[int(i/2)]}')
+            ST=$(grep "^soloStrand" "$i/Log.out" | grep RE-DEFINED | awk '{print $2}')
+
+            [[ -z "$ST" ]] && ST="Undef"
+
+            F2PCT=$(echo "$F2" | awk '{printf "%d\n",$1*100+0.5}')
+            if (( F2PCT <= 20 )); then
+                log_warn "Sample $i: GeneFull percentage ($F2PCT%) is too low!"
+            fi
+
+            echo -e "$i\t$R1\t$R2\t$CF\t$R3\t$C\t$GC\t$B\t$WL\t$REF\t$PAIRED\t$ST\t$G1\t$G2\t$E1\t$E2\t$F1\t$F2"
+        fi
+    done
+}
+
+# ---------- Help -------------------------------------------------------------
+
+show_qc_help() {
+    cat <<'EOF'
+Usage: starsolo qc <dir1> [dir2 … dirN] [options]
+
+Aggregate QC statistics across one or more STARsolo output directories.
+
+Arguments:
+  <dir>                     One or more STARsolo output directories.
+
+Options:
+  -s, --species <name>      Override species label in output (e.g. human, mouse).
+                            By default guessed from genomeDir in Log.out.
+  --no-contamination-check  Skip cross-sample barcode overlap check.
+  -h, --help                Show this help and exit.
+
+Examples:
+  starsolo qc sample1/ sample2/ | column -t
+  starsolo qc results/GSM* --species human
+  starsolo qc sample1/ sample2/ --no-contamination-check
+EOF
+}
diff --git a/scripts/solo_qc.sh b/scripts/solo_qc.sh
deleted file mode 100755
index f055d05..0000000
--- a/scripts/solo_qc.sh
+++ /dev/null
@@ -1,167 +0,0 @@
-#!/bin/bash
-# =============================================================================
-# solo_qc.sh — Aggregate QC statistics across STARsolo runs
-# =============================================================================
-# Run from the parent directory that contains one subdirectory per sample
-# (each produced by a starsolo run).
-#
-# Usage:
-#   starsolo qc                   # via the CLI
-#   ./scripts/solo_qc.sh          # standalone
-#
-# Pipe through `column -t` for pretty-printed output:
-#   starsolo qc | column -t
-# =============================================================================
-
-# --- Check completion status ------------------------------------------------
-
->&2 echo "Checking that all STARsolo jobs went to completion …"
-for i in */; do
-    i="${i%/}"
-    if [[ -d "$i/output" && -s "$i/Log.final.out" ]]; then
-        if [[ -d "$i/_STARtmp" ]]; then
-            >&2 echo "WARNING: Sample $i did not run to completion: _STARtmp is still present!"
-        fi
-    fi
-done
-
-# --- Check for cross-contamination -----------------------------------------
-
->&2 echo "Checking potential sample cross-contamination …"
-for i in */; do
-    i="${i%/}"
-    if [[ -s "$i/output/Gene/filtered/barcodes.tsv.gz" ]]; then
-        for j in */; do
-            j="${j%/}"
-            if [[ -s "$j/output/Gene/filtered/barcodes.tsv.gz" && "$i" != "$j" ]]; then
-                if [[ ! -s "sorted.$i.barcodes.tsv" ]]; then
-                    zcat "$i/output/Gene/filtered/barcodes.tsv.gz" | sort > "sorted.$i.barcodes.tsv" &
-                fi
-                if [[ ! -s "sorted.$j.barcodes.tsv" ]]; then
-                    zcat "$j/output/Gene/filtered/barcodes.tsv.gz" | sort > "sorted.$j.barcodes.tsv" &
-                fi
-                wait
-                N1=$(wc -l < "sorted.$i.barcodes.tsv")
-                N2=$(wc -l < "sorted.$j.barcodes.tsv")
-                MIN=$(( N1 <= N2 ? N1 : N2 ))
-                COMM=$(comm -12 "sorted.$i.barcodes.tsv" "sorted.$j.barcodes.tsv" | wc -l)
-                PCT=$(echo "$COMM" | awk -v v="$MIN" '{printf "%d\n",100*$1/v+0.5}')
-                if (( PCT >= 20 )); then
-                    >&2 echo "WARNING: Samples $i ($N1 barcodes) and $j ($N2 barcodes) share $COMM ($PCT%) barcodes — higher than expected!"
-                fi
-            fi
-        done
-    elif [[ -d "$i/output" && -s "$i/Log.out" ]]; then
-        >&2 echo "Sample $i: no filtered output detected (probably plate-based)."
-    fi
-done
-
-rm -f sorted.*.barcodes.tsv
-
-# --- Extract and output statistics ------------------------------------------
-
->&2 echo "Extracting STARsolo stats …"
->&2 echo
-
-echo -e "Sample\tRd_all\tRd_in_cells\tFrc_in_cells\tUMI_in_cells\tCells\tMed_nFeature\tGood_BC\tWL\tSpecies\tPaired\tStrand\tall_u+m\tall_u\texon_u+m\texon_u\tfull_u+m\tfull_u"
-
-for i in */; do
-    i="${i%/}"
-
-    if [[ -d "$i/output/Gene/filtered/" && -s "$i/Log.out" ]]; then
-        # --- Droplet-based ---
-        PAIRED="Single"
-        if grep -q "clip5pNbases 39 0" "$i/Log.out"; then
-            PAIRED="Paired"
-        fi
-
-        REF="Other"
-        if grep "^genomeDir" "$i/Log.out" | tail -n1 | grep -q "/human/"; then
-            REF="Human"
-        elif grep "^genomeDir" "$i/Log.out" | tail -n1 | grep -q "/mouse/"; then
-            REF="Mouse"
-        fi
-
-        WL="Undef"
-        if grep "^soloCBwhitelist" "$i/Log.out" | tail -n1 | grep -q "3M-february-2018.txt"; then
-            WL="v3"
-        elif grep "^soloCBwhitelist" "$i/Log.out" | tail -n1 | grep -q "737K-august-2016.txt"; then
-            WL="v2"
-        elif grep "^soloCBwhitelist" "$i/Log.out" | tail -n1 | grep -q "737K-april-2014_rc.txt"; then
-            WL="v1"
-        elif grep "^soloCBwhitelist" "$i/Log.out" | tail -n1 | grep -q "737K-arc-v1.txt"; then
-            WL="arc"
-        fi
-
-        R1=$(grep "Number of Reads,"             "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
-        B=$( grep "Reads With Valid Barcodes,"    "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
-        G1=$(grep "Reads Mapped to Genome: Unique+Multiple," "$i/output/Gene/Summary.csv" | awk -F "," '{print $2}')
-        G2=$(grep "Reads Mapped to Genome: Unique,"          "$i/output/Gene/Summary.csv" | awk -F "," '{print $2}')
-        E1=$(grep "Reads Mapped to Gene: Unique+Multip.*e Gene,"     "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
-        E2=$(grep "Reads Mapped to Gene: Unique Gene,"               "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
-        F1=$(grep "Reads Mapped to GeneFull: Unique+Multip.*e GeneFull," "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
-        F2=$(grep "Reads Mapped to GeneFull: Unique GeneFull,"           "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
-        C=$( grep "Estimated Number of Cells,"    "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
-        R2=$(grep "Unique Reads in Cells Mapped to GeneFull," "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
-        CF=$(echo "$R1" | awk -v v="$R2" '{printf "%.3f\n",v/$1}')
-        R3=$(grep "UMIs in Cells,"                "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
-        GC=$(grep "Median GeneFull per Cell,"      "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
-        ST=$(grep "^soloStrand" "$i/Log.out" | grep RE-DEFINED | awk '{print $2}')
-
-        if [[ -z "$ST" ]]; then
-            ST="Undef"
-        elif [[ "$PAIRED" == "Paired" ]]; then
-            ST="Reverse"
-        fi
-
-        F2PCT=$(echo "$F2" | awk '{printf "%d\n",$1*100+0.5}')
-        if (( F2PCT <= 20 )); then
-            >&2 echo "WARNING: Sample $i : GeneFull percentage ($F2PCT) is too low!"
-        fi
-
-        echo -e "$i\t$R1\t$R2\t$CF\t$R3\t$C\t$GC\t$B\t$WL\t$REF\t$PAIRED\t$ST\t$G1\t$G2\t$E1\t$E2\t$F1\t$F2"
-
-    elif [[ -d "$i/output" && -s "$i/Log.out" ]]; then
-        # --- Plate-based (Smart-seq2 etc.) ---
-        PAIRED="Single"
-        if grep -q "mate 2" "$i/Log.out"; then
-            PAIRED="Paired"
-        fi
-
-        REF="Other"
-        if grep "^genomeDir" "$i/Log.out" | tail -n1 | grep -q "/human/"; then
-            REF="Human"
-        elif grep "^genomeDir" "$i/Log.out" | tail -n1 | grep -q "/mouse/"; then
-            REF="Mouse"
-        fi
-
-        WL="Undef"
-        if grep -q "manifest" "$i/Log.out"; then
-            WL="None(Smart-seq)"
-        fi
-
-        R1=$(grep "Number of Reads,"             "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
-        B=$( grep "Reads With Valid Barcodes,"    "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
-        G1=$(grep "Reads Mapped to Genome: Unique+Multiple," "$i/output/Gene/Summary.csv" | awk -F "," '{print $2}')
-        G2=$(grep "Reads Mapped to Genome: Unique,"          "$i/output/Gene/Summary.csv" | awk -F "," '{print $2}')
-        E1=$(grep "Reads Mapped to Gene: Unique+Multip.*e Gene,"     "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
-        E2=$(grep "Reads Mapped to Gene: Unique Gene,"               "$i/output/Gene/Summary.csv"     | awk -F "," '{print $2}')
-        F1=$(grep "Reads Mapped to GeneFull: Unique+Multip.*e GeneFull," "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
-        F2=$(grep "Reads Mapped to GeneFull: Unique GeneFull,"           "$i/output/GeneFull/Summary.csv" | awk -F "," '{print $2}')
-        C=$( zcat "$i/output/Gene/raw/barcodes.tsv.gz" | wc -l)
-        R2=$(grep "yessubWLmatch_UniqueFeature" "$i/output/GeneFull/Features.stats" | awk '{print $2}')
-        CF=$(echo "$R1" | awk -v v="$R2" '{printf "%.3f\n",v/$1}')
-        R3=$(grep "yesUMIs" "$i/output/GeneFull/Features.stats" | awk '{print $2}')
-        GC=$(zcat "$i/output/GeneFull/raw/matrix.mtx.gz" | awk 'NR>3 {print $2}' | uniq -c | awk '{print $1}' | sort -n | awk '{a[i++]=$1} END {print a[int(i/2)]}')
-        ST=$(grep "^soloStrand" "$i/Log.out" | grep RE-DEFINED | awk '{print $2}')
-
-        [[ -z "$ST" ]] && ST="Undef"
-
-        F2PCT=$(echo "$F2" | awk '{printf "%d\n",$1*100+0.5}')
-        if (( F2PCT <= 20 )); then
-            >&2 echo "WARNING: Sample $i : GeneFull percentage ($F2PCT) is too low!"
-        fi
-
-        echo -e "$i\t$R1\t$R2\t$CF\t$R3\t$C\t$GC\t$B\t$WL\t$REF\t$PAIRED\t$ST\t$G1\t$G2\t$E1\t$E2\t$F1\t$F2"
-    fi
-done